Mutagenetix > Incidental Mutations

Incidental Mutation 'R2852:Cblc'

252307

Institutional Source

Beutler Lab

Gene Symbol

Cblc

Ensembl Gene

ENSMUSG00000040525

Gene Name

Casitas B-lineage lymphoma c

Synonyms

2310076I21Rik, Cbl3, 2310079L19Rik

MMRRC Submission

040445-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2852 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19778881-19796809 bp(-) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

A to G at 19780964 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]

Predicted Effect

probably null
Transcript: ENSMUST00000043822

SMART Domains

Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525

Domain	Start	End	E-Value	Type
Pfam:Cbl_N	13	144	2.6e-44	PFAM
Pfam:Cbl_N2	148	231	1.8e-35	PFAM
SH2	234	347	4.35e0	SMART
RING	350	388	1.92e-6	SMART
low complexity region	458	473	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108449

SMART Domains

Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525

Domain	Start	End	E-Value	Type
Pfam:Cbl_N	11	145	7.1e-20	PFAM
Pfam:Cbl_N2	147	231	2.3e-48	PFAM
SH2	234	333	5.28e0	SMART
low complexity region	414	429	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148416

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef4	A	C	1: 34,724,048	D795A	unknown	Het
Bank1	A	T	3: 136,242,940	S159T	possibly damaging	Het
Catsperd	A	G	17: 56,660,169		probably null	Het
Cfap54	T	C	10: 92,940,155	Y48C	probably damaging	Het
Chrng	A	G	1: 87,206,706	I156M	probably benign	Het
Dennd5a	A	T	7: 109,933,671	N297K	probably damaging	Het
Depdc5	A	G	5: 32,924,171	E559G	probably damaging	Het
Dzip1	A	C	14: 118,922,445	M117R	possibly damaging	Het
Ednrb	G	T	14: 103,821,674	S305R	probably benign	Het
Egflam	A	T	15: 7,219,701	W879R	probably damaging	Het
Ehbp1l1	T	A	19: 5,716,487	D332V	probably damaging	Het
Far1	T	C	7: 113,553,737	Y351H	possibly damaging	Het
Glrp1	GTGCTGCTGCTGCTGCTGCTGCTGCTG	GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	1: 88,503,275		probably benign	Het
Hspd1	A	T	1: 55,081,097	D315E	probably damaging	Het
Kap	T	C	6: 133,850,094	K92E	probably benign	Het
Kcnv2	T	C	19: 27,323,096	Y116H	probably benign	Het
Krt82	T	C	15: 101,548,435	Y170C	probably damaging	Het
Krtap13	T	C	16: 88,751,636		probably benign	Het
Man2a1	A	G	17: 64,713,601	K791E	probably benign	Het
Map4k4	T	A	1: 40,000,755		probably benign	Het
Mdc1	T	A	17: 35,849,010	V670D	probably benign	Het
Mre11a	A	G	9: 14,826,547	E599G	probably benign	Het
Mrln	T	C	10: 70,219,626	I44T	possibly damaging	Het
Mslnl	G	A	17: 25,742,934	V128M	probably damaging	Het
Mycbp2	A	T	14: 103,144,333	F3724I	probably damaging	Het
Npsr1	A	G	9: 24,310,005		probably benign	Het
Oosp3	T	A	19: 11,699,532		probably null	Het
Pah	T	A	10: 87,567,465	L131Q	probably damaging	Het
Pde6h	G	A	6: 136,963,208	C64Y	probably damaging	Het
Pdzd7	C	G	19: 45,027,674	V1003L	probably benign	Het
Pilra	T	A	5: 137,836,080	M14L	probably benign	Het
Prkdc	T	C	16: 15,652,552		probably null	Het
Rnf168	A	G	16: 32,282,374	E124G	probably damaging	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Spata1	A	G	3: 146,487,540	L96P	possibly damaging	Het
Stk11ip	A	G	1: 75,529,267		probably benign	Het
Stx5a	T	C	19: 8,755,112		probably benign	Het
Tek	A	G	4: 94,820,224	T340A	probably benign	Het
Tmeff1	T	A	4: 48,604,692		probably null	Het
Vmn2r85	T	A	10: 130,419,166	M550L	probably benign	Het
Wdr78	A	G	4: 103,096,661	S114P	probably benign	Het
Zfp14	A	G	7: 30,039,171	Y130H	probably benign	Het
Zfp653	A	T	9: 22,057,566	D426E	probably benign	Het
Zfyve28	G	A	5: 34,196,662	P834L	probably damaging	Het
Zkscan16	A	G	4: 58,957,364	T549A	possibly damaging	Het

Other mutations in Cblc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01510:Cblc	APN	7	19785275	missense	probably benign	0.00
R0583:Cblc	UTSW	7	19792561	missense	probably benign	0.41
R0847:Cblc	UTSW	7	19790534	nonsense	probably null
R1594:Cblc	UTSW	7	19792546	missense	probably damaging	1.00
R1626:Cblc	UTSW	7	19796502	missense	probably damaging	1.00
R1719:Cblc	UTSW	7	19790474	missense	probably benign	0.00
R1894:Cblc	UTSW	7	19792577	missense	probably damaging	0.99
R2011:Cblc	UTSW	7	19784822	missense	probably benign	0.01
R2395:Cblc	UTSW	7	19785380	missense	probably damaging	1.00
R3832:Cblc	UTSW	7	19792172	missense	probably damaging	0.98
R4696:Cblc	UTSW	7	19796482	missense	probably damaging	1.00
R5159:Cblc	UTSW	7	19785308	missense	probably benign	0.01
R5328:Cblc	UTSW	7	19792580	missense	possibly damaging	0.68
R5487:Cblc	UTSW	7	19784808	missense	probably benign	0.06
R5659:Cblc	UTSW	7	19792932	missense	probably damaging	1.00
R6209:Cblc	UTSW	7	19785305	missense	possibly damaging	0.47
R6519:Cblc	UTSW	7	19792863	missense	probably damaging	1.00
R6841:Cblc	UTSW	7	19792896	missense	probably damaging	1.00
R7371:Cblc	UTSW	7	19792903	missense	probably benign	0.00
R7417:Cblc	UTSW	7	19788974	missense	probably benign	0.41
R7494:Cblc	UTSW	7	19792812	missense	possibly damaging	0.76
R8195:Cblc	UTSW	7	19785337	missense	possibly damaging	0.78
R8253:Cblc	UTSW	7	19786232	missense	probably damaging	1.00
X0028:Cblc	UTSW	7	19785273	missense	probably benign
Z1177:Cblc	UTSW	7	19785278	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- CAACTCGGGGTCCTGTGG -3'
(R):5'- AAGCACTTCAAGAACAATTCTCTT -3'

Sequencing Primer
(F):5'- GTCCTGTGGGGTCTGCG -3'
(R):5'- TCCCGAGTGCTGGGATTAAAC -3'

Posted On

2014-12-04