Incidental Mutation 'R2852:Cblc'
ID252307
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission 040445-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2852 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 19780964 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably null
Transcript: ENSMUST00000043822
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108449
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148416
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Cfap54 T C 10: 92,940,155 Y48C probably damaging Het
Chrng A G 1: 87,206,706 I156M probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Ehbp1l1 T A 19: 5,716,487 D332V probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Kap T C 6: 133,850,094 K92E probably benign Het
Kcnv2 T C 19: 27,323,096 Y116H probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Krtap13 T C 16: 88,751,636 probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mrln T C 10: 70,219,626 I44T possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Oosp3 T A 19: 11,699,532 probably null Het
Pah T A 10: 87,567,465 L131Q probably damaging Het
Pde6h G A 6: 136,963,208 C64Y probably damaging Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Prkdc T C 16: 15,652,552 probably null Het
Rnf168 A G 16: 32,282,374 E124G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Stk11ip A G 1: 75,529,267 probably benign Het
Stx5a T C 19: 8,755,112 probably benign Het
Tek A G 4: 94,820,224 T340A probably benign Het
Tmeff1 T A 4: 48,604,692 probably null Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp14 A G 7: 30,039,171 Y130H probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7371:Cblc UTSW 7 19792903 missense probably benign 0.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
X0028:Cblc UTSW 7 19785273 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACTCGGGGTCCTGTGG -3'
(R):5'- AAGCACTTCAAGAACAATTCTCTT -3'

Sequencing Primer
(F):5'- GTCCTGTGGGGTCTGCG -3'
(R):5'- TCCCGAGTGCTGGGATTAAAC -3'
Posted On2014-12-04