Incidental Mutation 'R2852:Ednrb'
ID 252333
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 040445-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.716) question?
Stock # R2852 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 104059110 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 305 (S305R)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably benign
Transcript: ENSMUST00000022718
AA Change: S305R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: S305R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172237
AA Change: S305R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: S305R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227824
AA Change: S305R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,763,129 (GRCm39) D795A unknown Het
Bank1 A T 3: 135,948,701 (GRCm39) S159T possibly damaging Het
Catsperd A G 17: 56,967,169 (GRCm39) probably null Het
Cblc A G 7: 19,514,889 (GRCm39) probably null Het
Cfap54 T C 10: 92,776,017 (GRCm39) Y48C probably damaging Het
Chrng A G 1: 87,134,428 (GRCm39) I156M probably benign Het
Dennd5a A T 7: 109,532,878 (GRCm39) N297K probably damaging Het
Depdc5 A G 5: 33,081,515 (GRCm39) E559G probably damaging Het
Dnai4 A G 4: 102,953,858 (GRCm39) S114P probably benign Het
Dzip1 A C 14: 119,159,857 (GRCm39) M117R possibly damaging Het
Egflam A T 15: 7,249,182 (GRCm39) W879R probably damaging Het
Ehbp1l1 T A 19: 5,766,515 (GRCm39) D332V probably damaging Het
Far1 T C 7: 113,152,944 (GRCm39) Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,430,997 (GRCm39) probably benign Het
Hspd1 A T 1: 55,120,256 (GRCm39) D315E probably damaging Het
Kap T C 6: 133,827,057 (GRCm39) K92E probably benign Het
Kcnv2 T C 19: 27,300,496 (GRCm39) Y116H probably benign Het
Krt82 T C 15: 101,456,870 (GRCm39) Y170C probably damaging Het
Krtap13 T C 16: 88,548,524 (GRCm39) probably benign Het
Man2a1 A G 17: 65,020,596 (GRCm39) K791E probably benign Het
Map4k4 T A 1: 40,039,915 (GRCm39) probably benign Het
Mdc1 T A 17: 36,159,902 (GRCm39) V670D probably benign Het
Mre11a A G 9: 14,737,843 (GRCm39) E599G probably benign Het
Mrln T C 10: 70,055,456 (GRCm39) I44T possibly damaging Het
Mslnl G A 17: 25,961,908 (GRCm39) V128M probably damaging Het
Mycbp2 A T 14: 103,381,769 (GRCm39) F3724I probably damaging Het
Npsr1 A G 9: 24,221,301 (GRCm39) probably benign Het
Oosp3 T A 19: 11,676,896 (GRCm39) probably null Het
Pah T A 10: 87,403,327 (GRCm39) L131Q probably damaging Het
Pde6h G A 6: 136,940,206 (GRCm39) C64Y probably damaging Het
Pdzd7 C G 19: 45,016,113 (GRCm39) V1003L probably benign Het
Pilra T A 5: 137,834,342 (GRCm39) M14L probably benign Het
Prkdc T C 16: 15,470,416 (GRCm39) probably null Het
Rnf168 A G 16: 32,101,192 (GRCm39) E124G probably damaging Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Spata1 A G 3: 146,193,295 (GRCm39) L96P possibly damaging Het
Stk11ip A G 1: 75,505,911 (GRCm39) probably benign Het
Stx5a T C 19: 8,732,476 (GRCm39) probably benign Het
Tek A G 4: 94,708,461 (GRCm39) T340A probably benign Het
Tmeff1 T A 4: 48,604,692 (GRCm39) probably null Het
Vmn2r85 T A 10: 130,255,035 (GRCm39) M550L probably benign Het
Zfp14 A G 7: 29,738,596 (GRCm39) Y130H probably benign Het
Zfp653 A T 9: 21,968,862 (GRCm39) D426E probably benign Het
Zfyve28 G A 5: 34,354,006 (GRCm39) P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 (GRCm39) T549A possibly damaging Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5802:Ednrb UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTAATCGAGATTCCATCTTAAAAGG -3'
(R):5'- GTAGATATGGCCCACGAAACCC -3'

Sequencing Primer
(F):5'- CAACAACAAAAGTCAATGATTCTCTC -3'
(R):5'- TAGATATGGCCCACGAAACCCTATAC -3'
Posted On 2014-12-04