Incidental Mutation 'R2570:Dhcr24'
ID252336
Institutional Source Beutler Lab
Gene Symbol Dhcr24
Ensembl Gene ENSMUSG00000034926
Gene Name24-dehydrocholesterol reductase
Synonyms2310076D10Rik, seladin-1, 5830417J06Rik, 3-beta-hydroxysterol delta-24 reductase
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.826) question?
Stock #R2570 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location106561038-106589113 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106585832 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 355 (F355L)
Ref Sequence ENSEMBL: ENSMUSP00000038063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047973]
Predicted Effect probably benign
Transcript: ENSMUST00000047973
AA Change: F355L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000038063
Gene: ENSMUSG00000034926
AA Change: F355L

DomainStartEndE-ValueType
Pfam:FAD_binding_4 71 203 2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146976
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin adenine dinucleotide (FAD)-dependent oxidoreductase which catalyzes the reduction of the delta-24 double bond of sterol intermediates during cholesterol biosynthesis. The protein contains a leader sequence that directs it to the endoplasmic reticulum membrane. Missense mutations in this gene have been associated with desmosterolosis. Also, reduced expression of the gene occurs in the temporal cortex of Alzheimer disease patients and overexpression has been observed in adrenal gland cancer cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of having almost no plasma or tissue cholesterol, homozygous mutant mice are largely viable and display a mild growth phenotype. Inactivation did impair prenatal viability as well as infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Cdk12 T G 11: 98,203,792 M142R possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Olfr693 A G 7: 106,677,667 I273T probably benign Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Stradb C T 1: 58,988,584 T91I probably damaging Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tbl3 A T 17: 24,703,316 M405K possibly damaging Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tmem132a A T 19: 10,859,742 L612Q probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Dhcr24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Dhcr24 APN 4 106572278 missense possibly damaging 0.50
IGL01548:Dhcr24 APN 4 106573871 nonsense probably null
IGL02110:Dhcr24 APN 4 106573801 missense probably damaging 1.00
IGL02256:Dhcr24 APN 4 106572320 missense probably damaging 0.98
IGL02748:Dhcr24 APN 4 106564392 splice site probably benign
IGL02926:Dhcr24 APN 4 106586355 missense probably damaging 0.98
ANU22:Dhcr24 UTSW 4 106572278 missense possibly damaging 0.50
R0423:Dhcr24 UTSW 4 106586536 unclassified probably benign
R1632:Dhcr24 UTSW 4 106585951 missense probably benign
R1771:Dhcr24 UTSW 4 106578253 missense probably benign 0.00
R2138:Dhcr24 UTSW 4 106572302 nonsense probably null
R2139:Dhcr24 UTSW 4 106572302 nonsense probably null
R2420:Dhcr24 UTSW 4 106561094 start gained probably benign
R2422:Dhcr24 UTSW 4 106561094 start gained probably benign
R3176:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3276:Dhcr24 UTSW 4 106561239 missense probably benign 0.16
R3842:Dhcr24 UTSW 4 106585805 missense probably damaging 1.00
R3852:Dhcr24 UTSW 4 106573873 missense probably benign 0.02
R4037:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4038:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R4039:Dhcr24 UTSW 4 106573878 missense probably benign 0.01
R5831:Dhcr24 UTSW 4 106564414 missense probably benign 0.03
R7285:Dhcr24 UTSW 4 106571519 critical splice donor site probably null
R7821:Dhcr24 UTSW 4 106571436 missense possibly damaging 0.61
X0057:Dhcr24 UTSW 4 106586345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCACCTTACTGTGTTACTGGTC -3'
(R):5'- ACCCAGCTTACGTGGATGTC -3'

Sequencing Primer
(F):5'- GCCATTATAGTTGGTAAACCTGCGAG -3'
(R):5'- CCCAGCTTACGTGGATGTCATTTTG -3'
Posted On2014-12-04