Mutagenetix > Incidental Mutation

Incidental Mutation 'R0311:Adgre4'

25234

Institutional Source

Beutler Lab

Gene Symbol

Adgre4

Ensembl Gene

ENSMUSG00000032915

Gene Name

adhesion G protein-coupled receptor E4

Synonyms

Gpr127, EGF-TM7, FIRE, Emr4, D17Ertd479e

MMRRC Submission

038521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0311 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55749984-55853662 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55802010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Valine at position 339 (E339V)

Ref Sequence

ENSEMBL: ENSMUSP00000025004 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025004]

AlphaFold

Q91ZE5

Predicted Effect

probably benign
Transcript: ENSMUST00000025004
AA Change: E339V

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000025004
Gene: ENSMUSG00000032915
AA Change: E339V

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
Blast:EGF_like	38	76	2e-10	BLAST
Pfam:EGF_CA	77	117	3.6e-9	PFAM
GPS	288	338	4.03e-12	SMART
Pfam:7tm_2	343	588	5.7e-57	PFAM
low complexity region	613	628	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.6%
20x: 91.6%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	A	C	7: 120,402,904	M1547L	probably damaging	Het
Abcb4	A	G	5: 8,934,243	K658E	probably benign	Het
Abr	A	G	11: 76,509,127	S15P	possibly damaging	Het
Adgrb2	G	C	4: 130,017,129	A1168P	probably damaging	Het
Asprv1	T	C	6: 86,628,840	W223R	probably damaging	Het
Ccdc89	A	G	7: 90,426,693	E37G	probably damaging	Het
Cd48	C	A	1: 171,699,580	Y191*	probably null	Het
Chd4	T	C	6: 125,101,665	I257T	probably benign	Het
Clca4b	T	C	3: 144,932,496	M2V	probably benign	Het
Dnah11	A	T	12: 118,127,133	D1025E	probably benign	Het
Erich5	A	G	15: 34,472,939	*363W	probably null	Het
Etl4	A	G	2: 20,807,129	D1341G	probably damaging	Het
Fbxw11	A	G	11: 32,722,083	T184A	probably benign	Het
Fktn	A	G	4: 53,744,620	Q300R	probably benign	Het
G3bp1	T	C	11: 55,498,626	F383L	probably damaging	Het
Gdpd3	G	A	7: 126,767,189	R66Q	possibly damaging	Het
Hexb	A	G	13: 97,183,819		probably benign	Het
Kdm4b	A	G	17: 56,386,200	R346G	probably benign	Het
Mbtd1	T	A	11: 93,921,357		probably null	Het
Med23	T	A	10: 24,897,358	C653S	possibly damaging	Het
Nwd2	A	T	5: 63,804,998	I642L	probably damaging	Het
Olfr1444	A	G	19: 12,861,869	I31M	probably benign	Het
Olfr1448	T	A	19: 12,920,096	Y71F	possibly damaging	Het
Olfr912	T	C	9: 38,539,297	V134A	probably benign	Het
Pbld2	T	C	10: 63,054,507		probably null	Het
Pkd1l3	C	G	8: 109,623,649	D375E	possibly damaging	Het
Pkd1l3	G	A	8: 109,623,663	S380N	probably benign	Het
Plpp2	C	T	10: 79,527,580	R77K	probably damaging	Het
Pym1	G	T	10: 128,765,984	R168L	possibly damaging	Het
Rbm4	T	C	19: 4,787,556	Y300C	probably damaging	Het
Rnf207	A	G	4: 152,315,779	C175R	probably damaging	Het
Sema6a	G	A	18: 47,290,045		probably null	Het
Speg	T	C	1: 75,430,937	V3196A	probably damaging	Het
Syne1	T	A	10: 5,348,943	I1048L	possibly damaging	Het
Th	T	C	7: 142,896,041	E41G	probably damaging	Het
Tmx4	T	A	2: 134,598,526	*336L	probably null	Het
Tnfrsf18	T	C	4: 156,026,415	V10A	possibly damaging	Het
Tnxb	A	T	17: 34,716,984	I2670F	probably damaging	Het
Tpx2	T	C	2: 152,890,492	V562A	probably damaging	Het
Vmn2r73	A	G	7: 85,871,789	S324P	probably benign	Het
Vps18	T	C	2: 119,297,365	Y890H	probably benign	Het
Ythdc1	G	A	5: 86,835,705	D670N	probably damaging	Het

Other mutations in Adgre4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adgre4	APN	17	55791915	splice site	probably benign
IGL00228:Adgre4	APN	17	55802135	missense	probably damaging	1.00
IGL00572:Adgre4	APN	17	55820648	missense	probably benign	0.00
IGL01404:Adgre4	APN	17	55797639	missense	possibly damaging	0.63
IGL01420:Adgre4	APN	17	55799785	splice site	probably benign
IGL01501:Adgre4	APN	17	55802002	splice site	probably benign
IGL01510:Adgre4	APN	17	55818760	critical splice donor site	probably null
IGL01554:Adgre4	APN	17	55817090	missense	probably damaging	1.00
IGL01607:Adgre4	APN	17	55794748	splice site	probably benign
IGL01767:Adgre4	APN	17	55797740	missense	probably benign	0.19
IGL02253:Adgre4	APN	17	55760573	missense	probably benign	0.01
IGL02358:Adgre4	APN	17	55843209	missense	probably benign	0.15
IGL02466:Adgre4	APN	17	55814188	missense	probably benign	0.42
IGL03057:Adgre4	APN	17	55799602	splice site	probably benign
R0070:Adgre4	UTSW	17	55802154	missense	probably damaging	0.98
R0070:Adgre4	UTSW	17	55802154	missense	probably damaging	0.98
R0111:Adgre4	UTSW	17	55817073	missense	possibly damaging	0.92
R0366:Adgre4	UTSW	17	55792001	nonsense	probably null
R0415:Adgre4	UTSW	17	55852288	missense	probably benign	0.03
R0465:Adgre4	UTSW	17	55785137	splice site	probably benign
R0619:Adgre4	UTSW	17	55820679	missense	possibly damaging	0.52
R0685:Adgre4	UTSW	17	55792035	missense	probably benign	0.05
R0724:Adgre4	UTSW	17	55852281	missense	probably benign	0.00
R0835:Adgre4	UTSW	17	55799637	missense	probably damaging	1.00
R1330:Adgre4	UTSW	17	55778814	missense	probably benign	0.36
R1452:Adgre4	UTSW	17	55784996	missense	probably benign	0.35
R1960:Adgre4	UTSW	17	55791497	missense	probably benign
R1961:Adgre4	UTSW	17	55791497	missense	probably benign
R2046:Adgre4	UTSW	17	55778847	missense	possibly damaging	0.82
R2421:Adgre4	UTSW	17	55778872	missense	probably benign	0.10
R2570:Adgre4	UTSW	17	55778878	missense	possibly damaging	0.54
R3162:Adgre4	UTSW	17	55802218	splice site	probably benign
R4222:Adgre4	UTSW	17	55785121	missense	probably damaging	1.00
R4526:Adgre4	UTSW	17	55785016	nonsense	probably null
R4631:Adgre4	UTSW	17	55814305	missense	probably null	1.00
R4689:Adgre4	UTSW	17	55802096	missense	probably damaging	1.00
R4701:Adgre4	UTSW	17	55784971	missense	probably damaging	1.00
R4792:Adgre4	UTSW	17	55791491	missense	probably benign	0.00
R5205:Adgre4	UTSW	17	55794727	nonsense	probably null
R5210:Adgre4	UTSW	17	55785029	missense	probably damaging	0.97
R5358:Adgre4	UTSW	17	55818758	missense	probably benign	0.00
R5873:Adgre4	UTSW	17	55852282	missense	probably benign	0.13
R6025:Adgre4	UTSW	17	55792013	missense	probably benign	0.00
R6257:Adgre4	UTSW	17	55802133	missense	possibly damaging	0.87
R6426:Adgre4	UTSW	17	55802196	missense	probably benign	0.18
R6440:Adgre4	UTSW	17	55794744	critical splice donor site	probably null
R6484:Adgre4	UTSW	17	55802036	missense	possibly damaging	0.52
R6680:Adgre4	UTSW	17	55791959	missense	probably benign	0.09
R7086:Adgre4	UTSW	17	55820649	missense	probably benign	0.00
R7442:Adgre4	UTSW	17	55852340	missense	probably benign	0.04
R7467:Adgre4	UTSW	17	55791952	missense	probably benign	0.00
R7875:Adgre4	UTSW	17	55792016	missense	probably benign	0.00
R8007:Adgre4	UTSW	17	55814233	missense	probably damaging	0.99
R8096:Adgre4	UTSW	17	55820700	missense	probably damaging	1.00
R8172:Adgre4	UTSW	17	55797769	missense	probably benign	0.00
R8512:Adgre4	UTSW	17	55818760	critical splice donor site	probably null
R8972:Adgre4	UTSW	17	55802189	missense	probably damaging	1.00
R9018:Adgre4	UTSW	17	55791993	missense	probably benign	0.00
R9049:Adgre4	UTSW	17	55785094	missense	probably benign	0.05
S24628:Adgre4	UTSW	17	55852288	missense	probably benign	0.03
X0010:Adgre4	UTSW	17	55814308	missense	probably damaging	1.00
Z1177:Adgre4	UTSW	17	55814152	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGACTATCTGAGGGCCATCATGCT -3'
(R):5'- CTGTTGATGCCTGTGAGGAAGAGGA -3'

Sequencing Primer
(F):5'- TGAGGGCCATCATGCTACATAC -3'
(R):5'- TGAGGAAGAGGAGGTCAGCC -3'

Posted On

2013-04-16