Incidental Mutation 'R2852:Rnf168'
ID252343
Institutional Source Beutler Lab
Gene Symbol Rnf168
Ensembl Gene ENSMUSG00000014074
Gene Namering finger protein 168
Synonyms3110001H15Rik
MMRRC Submission 040445-MU
Accession Numbers

Ncbi RefSeq: NM_027355.2; MGI:1917488

Is this an essential gene? Probably essential (E-score: 0.892) question?
Stock #R2852 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32277459-32301434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32282374 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 124 (E124G)
Ref Sequence ENSEMBL: ENSMUSP00000126484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000155649] [ENSMUST00000171474]
Predicted Effect probably damaging
Transcript: ENSMUST00000014218
AA Change: E122G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074
AA Change: E122G

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155649
SMART Domains Protein: ENSMUSP00000115807
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171474
AA Change: E124G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074
AA Change: E124G

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin ligase protein that contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The protein is involved in DNA double-strand break (DSB) repair. Mutations in this gene result in Riddle syndrome. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit immunodeficient, increased radiosensitivity and age-dependent reduction in male infertility. [provided by MGI curators]
Allele List at MGI

All alleles(56) : Gene trapped(56)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Bank1 A T 3: 136,242,940 S159T possibly damaging Het
Catsperd A G 17: 56,660,169 probably null Het
Cblc A G 7: 19,780,964 probably null Het
Cfap54 T C 10: 92,940,155 Y48C probably damaging Het
Chrng A G 1: 87,206,706 I156M probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Depdc5 A G 5: 32,924,171 E559G probably damaging Het
Dzip1 A C 14: 118,922,445 M117R possibly damaging Het
Ednrb G T 14: 103,821,674 S305R probably benign Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Ehbp1l1 T A 19: 5,716,487 D332V probably damaging Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Kap T C 6: 133,850,094 K92E probably benign Het
Kcnv2 T C 19: 27,323,096 Y116H probably benign Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Krtap13 T C 16: 88,751,636 probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Map4k4 T A 1: 40,000,755 probably benign Het
Mdc1 T A 17: 35,849,010 V670D probably benign Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mrln T C 10: 70,219,626 I44T possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mycbp2 A T 14: 103,144,333 F3724I probably damaging Het
Npsr1 A G 9: 24,310,005 probably benign Het
Oosp3 T A 19: 11,699,532 probably null Het
Pah T A 10: 87,567,465 L131Q probably damaging Het
Pde6h G A 6: 136,963,208 C64Y probably damaging Het
Pdzd7 C G 19: 45,027,674 V1003L probably benign Het
Pilra T A 5: 137,836,080 M14L probably benign Het
Prkdc T C 16: 15,652,552 probably null Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Spata1 A G 3: 146,487,540 L96P possibly damaging Het
Stk11ip A G 1: 75,529,267 probably benign Het
Stx5a T C 19: 8,755,112 probably benign Het
Tek A G 4: 94,820,224 T340A probably benign Het
Tmeff1 T A 4: 48,604,692 probably null Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 A G 4: 103,096,661 S114P probably benign Het
Zfp14 A G 7: 30,039,171 Y130H probably benign Het
Zfp653 A T 9: 22,057,566 D426E probably benign Het
Zfyve28 G A 5: 34,196,662 P834L probably damaging Het
Zkscan16 A G 4: 58,957,364 T549A possibly damaging Het
Other mutations in Rnf168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02997:Rnf168 APN 16 32285421 missense probably damaging 1.00
IGL03108:Rnf168 APN 16 32278281 missense possibly damaging 0.79
P0021:Rnf168 UTSW 16 32298887 missense probably damaging 0.96
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0038:Rnf168 UTSW 16 32298995 missense probably benign 0.05
R0040:Rnf168 UTSW 16 32278173 unclassified probably null
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0049:Rnf168 UTSW 16 32298469 missense possibly damaging 0.56
R0760:Rnf168 UTSW 16 32298386 critical splice acceptor site probably null
R1188:Rnf168 UTSW 16 32298659 missense probably benign 0.00
R1386:Rnf168 UTSW 16 32298963 missense probably damaging 1.00
R1754:Rnf168 UTSW 16 32299124 missense probably benign
R2118:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2122:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2124:Rnf168 UTSW 16 32278218 missense probably damaging 1.00
R2520:Rnf168 UTSW 16 32278403 missense probably benign 0.17
R3418:Rnf168 UTSW 16 32299192 missense probably benign 0.00
R3419:Rnf168 UTSW 16 32299192 missense probably benign 0.00
R4886:Rnf168 UTSW 16 32299196 missense probably benign 0.00
R5335:Rnf168 UTSW 16 32298584 missense possibly damaging 0.78
R5738:Rnf168 UTSW 16 32282374 missense probably damaging 0.99
R6570:Rnf168 UTSW 16 32289210 missense probably benign 0.00
R7165:Rnf168 UTSW 16 32282361 missense probably benign 0.38
R7529:Rnf168 UTSW 16 32298914 missense probably damaging 0.98
R7556:Rnf168 UTSW 16 32299045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTTCTCTGTATAGCCCTGG -3'
(R):5'- GGAGGAGAGGGTATTGCAGTTAT -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GAGAGGGTATTGCAGTTATAAAGTC -3'
Posted On2014-12-04