Incidental Mutation 'R2570:Olfr693'
ID252366
Institutional Source Beutler Lab
Gene Symbol Olfr693
Ensembl Gene ENSMUSG00000051680
Gene Nameolfactory receptor 693
SynonymsGA_x6K02T2PBJ9-9055944-9054994, MOR283-8
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2570 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location106675005-106680584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106677667 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 273 (I273T)
Ref Sequence ENSEMBL: ENSMUSP00000150203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057817] [ENSMUST00000215541]
Predicted Effect probably benign
Transcript: ENSMUST00000057817
AA Change: I273T

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059679
Gene: ENSMUSG00000051680
AA Change: I273T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.2e-48 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215541
AA Change: I273T

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Cdk12 T G 11: 98,203,792 M142R possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Dhcr24 T C 4: 106,585,832 F355L probably benign Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Stradb C T 1: 58,988,584 T91I probably damaging Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tbl3 A T 17: 24,703,316 M405K possibly damaging Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tmem132a A T 19: 10,859,742 L612Q probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Olfr693
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Olfr693 APN 7 106677833 missense probably damaging 1.00
IGL01135:Olfr693 APN 7 106678193 missense probably benign 0.41
IGL03247:Olfr693 APN 7 106677547 missense probably benign 0.01
R0206:Olfr693 UTSW 7 106677574 missense probably benign 0.03
R1125:Olfr693 UTSW 7 106678007 missense possibly damaging 0.46
R1873:Olfr693 UTSW 7 106678484 start codon destroyed probably damaging 1.00
R1969:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1970:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1971:Olfr693 UTSW 7 106677670 missense probably damaging 0.99
R1972:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R1973:Olfr693 UTSW 7 106678219 missense probably benign 0.01
R3975:Olfr693 UTSW 7 106677785 missense probably damaging 1.00
R4840:Olfr693 UTSW 7 106678123 missense probably damaging 1.00
R5569:Olfr693 UTSW 7 106678483 start codon destroyed probably null 1.00
R6759:Olfr693 UTSW 7 106677893 missense probably benign
R6842:Olfr693 UTSW 7 106677886 missense probably damaging 1.00
R7108:Olfr693 UTSW 7 106678048 missense probably benign 0.03
R7565:Olfr693 UTSW 7 106678126 missense probably damaging 1.00
R7800:Olfr693 UTSW 7 106677574 missense probably benign 0.03
X0025:Olfr693 UTSW 7 106678249 missense probably damaging 1.00
Z1088:Olfr693 UTSW 7 106678457 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTTTGGTTCCAGAGTTCACTATC -3'
(R):5'- ATGGGTGTGACCTTGCTCATC -3'

Sequencing Primer
(F):5'- GGTTCCAGAGTTCACTATCAAAAG -3'
(R):5'- CCTCTTGCTGCCATACTGG -3'
Posted On2014-12-04