Incidental Mutation 'R0311:Kdm4b'
ID25237
Institutional Source Beutler Lab
Gene Symbol Kdm4b
Ensembl Gene ENSMUSG00000024201
Gene Namelysine (K)-specific demethylase 4B
SynonymsJmjd2b, 4732474L06Rik
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0311 (G1)
Quality Score200
Status Validated
Chromosome17
Chromosomal Location56326062-56402870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56386200 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 346 (R346G)
Ref Sequence ENSEMBL: ENSMUSP00000084045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025036] [ENSMUST00000086835]
Predicted Effect probably benign
Transcript: ENSMUST00000025036
AA Change: R346G

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025036
Gene: ENSMUSG00000024201
AA Change: R346G

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 719 777 2.5e-5 SMART
PHD 839 895 7.07e-5 SMART
TUDOR 905 962 1.68e-9 SMART
TUDOR 963 1019 7.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086835
AA Change: R346G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084045
Gene: ENSMUSG00000024201
AA Change: R346G

DomainStartEndE-ValueType
JmjN 14 56 5.88e-17 SMART
low complexity region 61 68 N/A INTRINSIC
JmjC 143 309 1.19e-59 SMART
low complexity region 349 361 N/A INTRINSIC
low complexity region 380 399 N/A INTRINSIC
low complexity region 443 449 N/A INTRINSIC
low complexity region 481 495 N/A INTRINSIC
low complexity region 511 537 N/A INTRINSIC
PHD 712 770 2.5e-5 SMART
PHD 832 888 7.07e-5 SMART
TUDOR 898 954 2.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132363
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele lacking demethylase activity exhibit no gross abnormalities. Mice homozygous for a conditional allele activated in mammary gland epithelial cells exhibit delayed mammary gland development with reduced branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rbm4 T C 19: 4,787,556 Y300C probably damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Kdm4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Kdm4b APN 17 56353019 missense probably benign 0.28
IGL01408:Kdm4b APN 17 56353518 splice site probably benign
IGL01610:Kdm4b APN 17 56353522 splice site probably benign
IGL01936:Kdm4b APN 17 56397355 missense probably damaging 1.00
IGL01964:Kdm4b APN 17 56389256 splice site probably null
IGL02151:Kdm4b APN 17 56396234 missense probably benign 0.05
IGL02596:Kdm4b APN 17 56399706 missense probably benign 0.14
IGL02975:Kdm4b APN 17 56375996 splice site probably null
IGL03172:Kdm4b APN 17 56401649 missense probably damaging 0.98
Coelestinum UTSW 17 56353091 missense probably benign 0.31
mistflower UTSW 17 56389564 missense possibly damaging 0.65
R0193:Kdm4b UTSW 17 56393952 missense probably benign 0.04
R0331:Kdm4b UTSW 17 56386289 splice site probably benign
R1109:Kdm4b UTSW 17 56399430 missense probably damaging 0.99
R1499:Kdm4b UTSW 17 56400025 missense probably damaging 1.00
R1895:Kdm4b UTSW 17 56397340 missense probably damaging 1.00
R1985:Kdm4b UTSW 17 56401302 missense probably damaging 1.00
R2087:Kdm4b UTSW 17 56389564 missense possibly damaging 0.65
R2185:Kdm4b UTSW 17 56393750 missense probably benign 0.00
R2904:Kdm4b UTSW 17 56355884 missense probably benign 0.03
R3792:Kdm4b UTSW 17 56355944 missense probably damaging 1.00
R3897:Kdm4b UTSW 17 56396955 missense probably damaging 1.00
R4661:Kdm4b UTSW 17 56399459 missense probably damaging 1.00
R4685:Kdm4b UTSW 17 56401675 missense probably benign 0.06
R4716:Kdm4b UTSW 17 56386178 missense probably benign 0.10
R4790:Kdm4b UTSW 17 56401618 missense probably damaging 0.97
R4864:Kdm4b UTSW 17 56353091 missense probably benign 0.31
R5700:Kdm4b UTSW 17 56351700 missense possibly damaging 0.93
R5963:Kdm4b UTSW 17 56399732 missense probably damaging 1.00
R6003:Kdm4b UTSW 17 56396916 missense probably damaging 1.00
R6029:Kdm4b UTSW 17 56396576 missense probably damaging 0.98
R6769:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6771:Kdm4b UTSW 17 56351754 missense possibly damaging 0.54
R6927:Kdm4b UTSW 17 56399435 missense probably damaging 1.00
R7041:Kdm4b UTSW 17 56396592 missense probably damaging 0.96
R7230:Kdm4b UTSW 17 56369155 missense probably damaging 1.00
R7275:Kdm4b UTSW 17 56396333 missense probably damaging 0.99
R7454:Kdm4b UTSW 17 56389639 missense probably benign 0.00
R7455:Kdm4b UTSW 17 56396657 missense probably damaging 0.98
R7457:Kdm4b UTSW 17 56396319 missense probably damaging 1.00
X0024:Kdm4b UTSW 17 56401278 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGATGCCATGTCCATCTTCCC -3'
(R):5'- AGCAGCAAGCATTCAGATGCCC -3'

Sequencing Primer
(F):5'- GGCCTGAACTAGCAGTCTCATC -3'
(R):5'- GGTCTGAGGCTCTGCCTG -3'
Posted On2013-04-16