Incidental Mutation 'R2853:Cubn'
ID 252375
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin (intrinsic factor-cobalamin receptor)
Synonyms D2Wsu88e
MMRRC Submission 040446-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2853 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 13276338-13491813 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 13430834 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1104 (V1104I)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000091436
AA Change: V1104I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: V1104I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195447
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A C 16: 8,600,968 (GRCm38) K142T probably damaging Het
Als2cl T C 9: 110,894,135 (GRCm38) S636P probably damaging Het
Angptl7 T C 4: 148,500,279 (GRCm38) E4G probably benign Het
Aph1c T C 9: 66,834,482 (GRCm38) probably null Het
Arhgap23 T C 11: 97,492,594 (GRCm38) probably null Het
Arhgef4 A C 1: 34,724,048 (GRCm38) D795A unknown Het
Ccdc85a A G 11: 28,392,942 (GRCm38) probably benign Het
Chchd1 T C 14: 20,704,220 (GRCm38) S67P probably benign Het
Dennd5a A T 7: 109,933,671 (GRCm38) N297K probably damaging Het
Egflam A T 15: 7,219,701 (GRCm38) W879R probably damaging Het
Fam214b A G 4: 43,036,293 (GRCm38) L146P probably benign Het
Far1 T C 7: 113,553,737 (GRCm38) Y351H possibly damaging Het
Gpr62 T C 9: 106,464,712 (GRCm38) E339G probably benign Het
Hspd1 A T 1: 55,081,097 (GRCm38) D315E probably damaging Het
Ids G T X: 70,353,170 (GRCm38) T329K probably damaging Het
Itga9 G A 9: 118,636,536 (GRCm38) E153K probably damaging Het
Krt82 T C 15: 101,548,435 (GRCm38) Y170C probably damaging Het
Megf10 T C 18: 57,293,931 (GRCm38) I1107T probably damaging Het
Mre11a A G 9: 14,826,547 (GRCm38) E599G probably benign Het
Mtm1 T G X: 71,301,783 (GRCm38) I437S probably damaging Het
Ncoa2 C T 1: 13,186,889 (GRCm38) V129I probably damaging Het
Ncs1 T C 2: 31,287,317 (GRCm38) F169L probably damaging Het
Ndst2 T C 14: 20,729,896 (GRCm38) E92G probably damaging Het
Parm1 T C 5: 91,594,265 (GRCm38) V164A probably benign Het
Pkhd1 T C 1: 20,058,302 (GRCm38) Q4059R probably benign Het
Scgb1b20 A C 7: 33,373,524 (GRCm38) K52N possibly damaging Het
Setbp1 T A 18: 78,923,996 (GRCm38) Q171L probably benign Het
Sik2 A T 9: 50,898,297 (GRCm38) L612Q probably damaging Het
Srprb G A 9: 103,198,839 (GRCm38) Q800* probably null Het
Ss18l1 A G 2: 180,058,121 (GRCm38) Y258C probably damaging Het
Togaram1 A G 12: 65,016,612 (GRCm38) K1567R probably benign Het
Ttc6 T C 12: 57,576,181 (GRCm38) F122S probably damaging Het
Vmn2r85 T A 10: 130,419,166 (GRCm38) M550L probably benign Het
Wdr78 T C 4: 103,050,158 (GRCm38) I644V possibly damaging Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,491,820 (GRCm38) unclassified probably benign
IGL00228:Cubn APN 2 13,456,697 (GRCm38) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,381,849 (GRCm38) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,427,056 (GRCm38) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,278,418 (GRCm38) missense probably benign 0.00
IGL00519:Cubn APN 2 13,282,919 (GRCm38) missense probably benign 0.00
IGL00562:Cubn APN 2 13,294,230 (GRCm38) missense probably benign 0.01
IGL00678:Cubn APN 2 13,467,710 (GRCm38) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,381,927 (GRCm38) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,456,623 (GRCm38) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,278,408 (GRCm38) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,478,093 (GRCm38) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,310,566 (GRCm38) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,465,908 (GRCm38) missense probably benign 0.31
IGL01418:Cubn APN 2 13,284,041 (GRCm38) missense probably benign 0.01
IGL01450:Cubn APN 2 13,350,862 (GRCm38) splice site probably benign
IGL01534:Cubn APN 2 13,465,933 (GRCm38) nonsense probably null
IGL01584:Cubn APN 2 13,308,661 (GRCm38) splice site probably benign
IGL01595:Cubn APN 2 13,325,216 (GRCm38) missense probably benign 0.05
IGL01625:Cubn APN 2 13,306,274 (GRCm38) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,489,936 (GRCm38) nonsense probably null
IGL01972:Cubn APN 2 13,446,072 (GRCm38) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,287,594 (GRCm38) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,339,846 (GRCm38) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,381,837 (GRCm38) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,427,834 (GRCm38) splice site probably null
IGL02491:Cubn APN 2 13,321,228 (GRCm38) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,325,226 (GRCm38) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,446,032 (GRCm38) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,445,040 (GRCm38) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,294,370 (GRCm38) missense probably benign 0.07
IGL02897:Cubn APN 2 13,318,312 (GRCm38) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,287,094 (GRCm38) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,355,689 (GRCm38) missense probably benign 0.09
IGL03289:Cubn APN 2 13,426,967 (GRCm38) missense probably benign 0.00
IGL03335:Cubn APN 2 13,360,329 (GRCm38) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,478,057 (GRCm38) splice site probably null
mellow UTSW 2 13,478,078 (GRCm38) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,468,852 (GRCm38) nonsense probably null
PIT4495001:Cubn UTSW 2 13,491,750 (GRCm38) missense probably benign 0.00
R0145:Cubn UTSW 2 13,306,432 (GRCm38) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,356,709 (GRCm38) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,476,035 (GRCm38) critical splice donor site probably null
R0254:Cubn UTSW 2 13,440,514 (GRCm38) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,424,694 (GRCm38) missense probably benign 0.01
R0360:Cubn UTSW 2 13,310,507 (GRCm38) splice site probably benign
R0364:Cubn UTSW 2 13,310,507 (GRCm38) splice site probably benign
R0383:Cubn UTSW 2 13,430,959 (GRCm38) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,469,764 (GRCm38) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,469,763 (GRCm38) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,444,267 (GRCm38) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,428,680 (GRCm38) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,360,252 (GRCm38) splice site probably null
R0735:Cubn UTSW 2 13,491,689 (GRCm38) splice site probably benign
R0780:Cubn UTSW 2 13,456,613 (GRCm38) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,362,328 (GRCm38) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,336,242 (GRCm38) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,445,000 (GRCm38) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,287,568 (GRCm38) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,360,319 (GRCm38) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,325,288 (GRCm38) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,325,288 (GRCm38) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,476,120 (GRCm38) missense probably benign 0.04
R1508:Cubn UTSW 2 13,427,105 (GRCm38) missense probably benign 0.25
R1532:Cubn UTSW 2 13,287,661 (GRCm38) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,427,967 (GRCm38) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,469,789 (GRCm38) missense probably benign 0.00
R1761:Cubn UTSW 2 13,489,317 (GRCm38) critical splice donor site probably null
R1862:Cubn UTSW 2 13,308,561 (GRCm38) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,323,002 (GRCm38) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,310,526 (GRCm38) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,278,538 (GRCm38) missense probably benign 0.01
R1960:Cubn UTSW 2 13,340,017 (GRCm38) splice site probably null
R2021:Cubn UTSW 2 13,308,549 (GRCm38) missense probably benign 0.09
R2137:Cubn UTSW 2 13,336,167 (GRCm38) missense probably benign 0.01
R2138:Cubn UTSW 2 13,444,378 (GRCm38) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,336,167 (GRCm38) missense probably benign 0.01
R2179:Cubn UTSW 2 13,318,242 (GRCm38) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,404,080 (GRCm38) nonsense probably null
R2369:Cubn UTSW 2 13,491,217 (GRCm38) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,476,150 (GRCm38) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,318,272 (GRCm38) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,278,356 (GRCm38) splice site probably null
R2850:Cubn UTSW 2 13,322,953 (GRCm38) missense probably damaging 1.00
R2893:Cubn UTSW 2 13,358,139 (GRCm38) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,362,347 (GRCm38) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,362,347 (GRCm38) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,358,162 (GRCm38) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,333,508 (GRCm38) missense probably benign 0.00
R3703:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,350,943 (GRCm38) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,331,585 (GRCm38) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,427,914 (GRCm38) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,360,353 (GRCm38) missense probably benign 0.01
R3813:Cubn UTSW 2 13,294,325 (GRCm38) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,283,008 (GRCm38) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,283,008 (GRCm38) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,286,980 (GRCm38) critical splice donor site probably null
R3921:Cubn UTSW 2 13,326,677 (GRCm38) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,313,999 (GRCm38) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,428,563 (GRCm38) intron probably benign
R4405:Cubn UTSW 2 13,466,030 (GRCm38) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,428,749 (GRCm38) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,313,979 (GRCm38) splice site probably null
R4770:Cubn UTSW 2 13,314,767 (GRCm38) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,287,024 (GRCm38) missense possibly damaging 0.94
R4799:Cubn UTSW 2 13,351,058 (GRCm38) missense probably damaging 1.00
R4812:Cubn UTSW 2 13,459,076 (GRCm38) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,325,225 (GRCm38) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,489,910 (GRCm38) missense probably benign 0.06
R4967:Cubn UTSW 2 13,348,045 (GRCm38) missense probably benign 0.01
R5187:Cubn UTSW 2 13,287,568 (GRCm38) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,478,202 (GRCm38) nonsense probably null
R5305:Cubn UTSW 2 13,388,939 (GRCm38) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,491,695 (GRCm38) splice site probably null
R5530:Cubn UTSW 2 13,308,523 (GRCm38) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,350,932 (GRCm38) missense probably benign 0.00
R5737:Cubn UTSW 2 13,388,891 (GRCm38) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,320,023 (GRCm38) splice site probably benign
R5923:Cubn UTSW 2 13,486,078 (GRCm38) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,325,184 (GRCm38) missense probably benign 0.12
R6032:Cubn UTSW 2 13,325,184 (GRCm38) missense probably benign 0.12
R6084:Cubn UTSW 2 13,430,897 (GRCm38) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,427,847 (GRCm38) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,308,618 (GRCm38) missense probably benign 0.29
R6181:Cubn UTSW 2 13,349,876 (GRCm38) missense probably benign 0.31
R6301:Cubn UTSW 2 13,478,078 (GRCm38) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,280,195 (GRCm38) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,476,123 (GRCm38) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,430,995 (GRCm38) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,427,835 (GRCm38) critical splice donor site probably null
R6393:Cubn UTSW 2 13,355,680 (GRCm38) missense probably benign 0.08
R6408:Cubn UTSW 2 13,294,203 (GRCm38) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,459,002 (GRCm38) missense probably benign 0.01
R6599:Cubn UTSW 2 13,310,673 (GRCm38) missense possibly damaging 0.95
R6629:Cubn UTSW 2 13,430,872 (GRCm38) missense probably damaging 1.00
R6641:Cubn UTSW 2 13,476,064 (GRCm38) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,321,255 (GRCm38) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,445,029 (GRCm38) missense probably benign 0.21
R6847:Cubn UTSW 2 13,444,253 (GRCm38) critical splice donor site probably null
R6885:Cubn UTSW 2 13,318,278 (GRCm38) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,348,029 (GRCm38) missense probably benign 0.03
R6973:Cubn UTSW 2 13,381,837 (GRCm38) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,486,789 (GRCm38) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,306,281 (GRCm38) missense probably benign 0.10
R7076:Cubn UTSW 2 13,306,280 (GRCm38) missense probably benign 0.00
R7086:Cubn UTSW 2 13,319,858 (GRCm38) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,342,498 (GRCm38) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,351,003 (GRCm38) missense probably benign 0.01
R7292:Cubn UTSW 2 13,424,739 (GRCm38) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,340,332 (GRCm38) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,468,771 (GRCm38) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,287,064 (GRCm38) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,426,967 (GRCm38) missense probably benign 0.00
R7429:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,322,993 (GRCm38) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,455,509 (GRCm38) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,489,917 (GRCm38) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,348,178 (GRCm38) missense probably benign
R7700:Cubn UTSW 2 13,489,917 (GRCm38) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,348,178 (GRCm38) missense probably benign
R7751:Cubn UTSW 2 13,360,365 (GRCm38) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,280,078 (GRCm38) missense probably benign 0.11
R7759:Cubn UTSW 2 13,348,150 (GRCm38) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,468,869 (GRCm38) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,424,727 (GRCm38) missense probably benign 0.22
R7988:Cubn UTSW 2 13,332,355 (GRCm38) missense probably benign 0.43
R8010:Cubn UTSW 2 13,336,086 (GRCm38) critical splice donor site probably null
R8020:Cubn UTSW 2 13,479,178 (GRCm38) missense probably benign 0.01
R8120:Cubn UTSW 2 13,331,660 (GRCm38) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,388,848 (GRCm38) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,294,318 (GRCm38) missense probably benign 0.11
R8224:Cubn UTSW 2 13,349,877 (GRCm38) missense probably benign 0.16
R8289:Cubn UTSW 2 13,486,802 (GRCm38) missense probably benign 0.10
R8326:Cubn UTSW 2 13,306,463 (GRCm38) missense probably benign 0.01
R8331:Cubn UTSW 2 13,340,242 (GRCm38) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,430,847 (GRCm38) missense probably benign 0.08
R8341:Cubn UTSW 2 13,428,724 (GRCm38) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,325,160 (GRCm38) missense probably benign 0.17
R8427:Cubn UTSW 2 13,428,756 (GRCm38) missense probably benign 0.00
R8432:Cubn UTSW 2 13,381,799 (GRCm38) missense probably benign 0.00
R8441:Cubn UTSW 2 13,427,847 (GRCm38) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,314,044 (GRCm38) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,308,520 (GRCm38) critical splice donor site probably null
R8699:Cubn UTSW 2 13,383,959 (GRCm38) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,308,566 (GRCm38) nonsense probably null
R8874:Cubn UTSW 2 13,360,346 (GRCm38) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,456,655 (GRCm38) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,287,103 (GRCm38) missense probably benign 0.02
R9143:Cubn UTSW 2 13,332,465 (GRCm38) splice site probably benign
R9261:Cubn UTSW 2 13,278,451 (GRCm38) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,381,892 (GRCm38) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,458,956 (GRCm38) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,287,699 (GRCm38) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,478,134 (GRCm38) missense probably benign 0.00
R9615:Cubn UTSW 2 13,321,180 (GRCm38) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,314,718 (GRCm38) missense probably benign 0.04
R9774:Cubn UTSW 2 13,428,719 (GRCm38) missense probably benign
X0018:Cubn UTSW 2 13,458,986 (GRCm38) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,476,076 (GRCm38) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,342,581 (GRCm38) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,322,962 (GRCm38) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,383,992 (GRCm38) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,294,229 (GRCm38) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,381,825 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCACTTCCTTTGCCTAAGTAAAC -3'
(R):5'- TCCCTTCACAGTGTGTTTATATGAC -3'

Sequencing Primer
(F):5'- TAGAGGATCAAACATCTCTTCCTGC -3'
(R):5'- GACTATACAGATAATTTTGGGAGGC -3'
Posted On 2014-12-04