Incidental Mutation 'R2570:Cdk12'
ID252394
Institutional Source Beutler Lab
Gene Symbol Cdk12
Ensembl Gene ENSMUSG00000003119
Gene Namecyclin-dependent kinase 12
SynonymsCrkrs, 1810022J16Rik, D11Ertd752e, Crk7
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2570 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98203059-98278504 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 98203792 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 142 (M142R)
Ref Sequence ENSEMBL: ENSMUSP00000103163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003203] [ENSMUST00000107538] [ENSMUST00000107539]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003203
AA Change: M142R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003203
Gene: ENSMUSG00000003119
AA Change: M142R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107538
AA Change: M142R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103162
Gene: ENSMUSG00000003119
AA Change: M142R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1252 1276 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107539
AA Change: M142R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000103163
Gene: ENSMUSG00000003119
AA Change: M142R

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 40 51 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 103 123 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 166 177 N/A INTRINSIC
low complexity region 214 227 N/A INTRINSIC
low complexity region 286 384 N/A INTRINSIC
low complexity region 511 568 N/A INTRINSIC
low complexity region 623 633 N/A INTRINSIC
low complexity region 666 684 N/A INTRINSIC
S_TKc 723 1016 1.49e-95 SMART
low complexity region 1253 1267 N/A INTRINSIC
low complexity region 1458 1474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality between implantation and E6.5 with decreased proliferation and increased apoptosis in the inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Dhcr24 T C 4: 106,585,832 F355L probably benign Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Olfr693 A G 7: 106,677,667 I273T probably benign Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Stradb C T 1: 58,988,584 T91I probably damaging Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tbl3 A T 17: 24,703,316 M405K possibly damaging Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tmem132a A T 19: 10,859,742 L612Q probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Cdk12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Cdk12 APN 11 98245388 missense unknown
IGL00718:Cdk12 APN 11 98249676 intron probably benign
IGL00850:Cdk12 APN 11 98222665 missense unknown
IGL01299:Cdk12 APN 11 98210446 missense unknown
IGL01443:Cdk12 APN 11 98245469 missense unknown
IGL01597:Cdk12 APN 11 98250264 unclassified probably benign
capsized UTSW 11 98241785 missense unknown
Listing UTSW 11 98224467 nonsense probably null
R0124:Cdk12 UTSW 11 98211247 splice site probably benign
R0157:Cdk12 UTSW 11 98249776 unclassified probably benign
R0190:Cdk12 UTSW 11 98241831 critical splice donor site probably null
R0230:Cdk12 UTSW 11 98203991 missense probably damaging 1.00
R0467:Cdk12 UTSW 11 98203579 missense probably damaging 0.99
R0577:Cdk12 UTSW 11 98203506 missense probably damaging 0.99
R0671:Cdk12 UTSW 11 98230109 splice site probably benign
R0834:Cdk12 UTSW 11 98204385 missense probably benign 0.23
R1129:Cdk12 UTSW 11 98245375 missense unknown
R1337:Cdk12 UTSW 11 98245671 critical splice donor site probably null
R1344:Cdk12 UTSW 11 98241785 missense unknown
R1418:Cdk12 UTSW 11 98241785 missense unknown
R1729:Cdk12 UTSW 11 98249970 unclassified probably benign
R1756:Cdk12 UTSW 11 98241761 nonsense probably null
R1784:Cdk12 UTSW 11 98249970 unclassified probably benign
R1807:Cdk12 UTSW 11 98210377 missense unknown
R1956:Cdk12 UTSW 11 98219216 missense probably benign 0.23
R1966:Cdk12 UTSW 11 98204090 nonsense probably null
R2202:Cdk12 UTSW 11 98210638 missense unknown
R2422:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R4574:Cdk12 UTSW 11 98220988 intron probably benign
R4614:Cdk12 UTSW 11 98249777 unclassified probably benign
R4882:Cdk12 UTSW 11 98210446 missense unknown
R4921:Cdk12 UTSW 11 98222687 missense unknown
R5151:Cdk12 UTSW 11 98249923 unclassified probably benign
R5252:Cdk12 UTSW 11 98243509 missense unknown
R5348:Cdk12 UTSW 11 98204292 missense probably benign 0.23
R5620:Cdk12 UTSW 11 98210983 missense unknown
R5779:Cdk12 UTSW 11 98219074 missense probably benign 0.23
R6085:Cdk12 UTSW 11 98243429 missense unknown
R6293:Cdk12 UTSW 11 98224553 missense unknown
R6371:Cdk12 UTSW 11 98245288 missense unknown
R6438:Cdk12 UTSW 11 98224467 nonsense probably null
R6765:Cdk12 UTSW 11 98224529 missense unknown
R6958:Cdk12 UTSW 11 98241699 missense unknown
R7205:Cdk12 UTSW 11 98224625 missense unknown
R7307:Cdk12 UTSW 11 98249800 nonsense probably null
R7361:Cdk12 UTSW 11 98210468 nonsense probably null
R7365:Cdk12 UTSW 11 98221084 missense unknown
R7447:Cdk12 UTSW 11 98245280 missense unknown
R7514:Cdk12 UTSW 11 98222658 missense unknown
R7831:Cdk12 UTSW 11 98249827 missense unknown
R7877:Cdk12 UTSW 11 98240835 missense unknown
R7975:Cdk12 UTSW 11 98221102 missense unknown
R8507:Cdk12 UTSW 11 98250285 missense unknown
Z1176:Cdk12 UTSW 11 98203941 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGGCCTTCAAATCAGACCG -3'
(R):5'- TGGATCTCCGTTTAGGGCTAGC -3'

Sequencing Primer
(F):5'- CGGAGGGAGAACGAGGAAC -3'
(R):5'- GCTAGCCACGGTTTTGTAAC -3'
Posted On2014-12-04