Incidental Mutation 'R0311:Rbm4'
ID25241
Institutional Source Beutler Lab
Gene Symbol Rbm4
Ensembl Gene ENSMUSG00000094936
Gene NameRNA binding motif protein 4
SynonymsLark1, Rbm4a
MMRRC Submission 038521-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R0311 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4784293-4793901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4787556 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 300 (Y300C)
Ref Sequence ENSEMBL: ENSMUSP00000137345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164209] [ENSMUST00000164376] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000178615] [ENSMUST00000179189] [ENSMUST00000179909] [ENSMUST00000180248]
Predicted Effect probably benign
Transcript: ENSMUST00000164209
SMART Domains Protein: ENSMUSP00000129745
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164376
SMART Domains Protein: ENSMUSP00000127564
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 172 4.62e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172000
AA Change: Y416C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370
AA Change: Y416C

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect probably benign
Transcript: ENSMUST00000178615
SMART Domains Protein: ENSMUSP00000136254
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178727
Predicted Effect probably benign
Transcript: ENSMUST00000179189
SMART Domains Protein: ENSMUSP00000137174
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179820
Predicted Effect unknown
Transcript: ENSMUST00000179909
AA Change: Y275C
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370
AA Change: Y275C

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180248
AA Change: Y300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137345
Gene: ENSMUSG00000094936
AA Change: Y300C

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
low complexity region 227 246 N/A INTRINSIC
low complexity region 283 296 N/A INTRINSIC
Meta Mutation Damage Score 0.1698 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.6%
  • 20x: 91.6%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced postnatal body weight, decreased insulin levels, smaller pancreatic islets and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A C 7: 120,402,904 M1547L probably damaging Het
Abcb4 A G 5: 8,934,243 K658E probably benign Het
Abr A G 11: 76,509,127 S15P possibly damaging Het
Adgrb2 G C 4: 130,017,129 A1168P probably damaging Het
Adgre4 A T 17: 55,802,010 E339V probably benign Het
Asprv1 T C 6: 86,628,840 W223R probably damaging Het
Ccdc89 A G 7: 90,426,693 E37G probably damaging Het
Cd48 C A 1: 171,699,580 Y191* probably null Het
Chd4 T C 6: 125,101,665 I257T probably benign Het
Clca4b T C 3: 144,932,496 M2V probably benign Het
Dnah11 A T 12: 118,127,133 D1025E probably benign Het
Erich5 A G 15: 34,472,939 *363W probably null Het
Etl4 A G 2: 20,807,129 D1341G probably damaging Het
Fbxw11 A G 11: 32,722,083 T184A probably benign Het
Fktn A G 4: 53,744,620 Q300R probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gdpd3 G A 7: 126,767,189 R66Q possibly damaging Het
Hexb A G 13: 97,183,819 probably benign Het
Kdm4b A G 17: 56,386,200 R346G probably benign Het
Mbtd1 T A 11: 93,921,357 probably null Het
Med23 T A 10: 24,897,358 C653S possibly damaging Het
Nwd2 A T 5: 63,804,998 I642L probably damaging Het
Olfr1444 A G 19: 12,861,869 I31M probably benign Het
Olfr1448 T A 19: 12,920,096 Y71F possibly damaging Het
Olfr912 T C 9: 38,539,297 V134A probably benign Het
Pbld2 T C 10: 63,054,507 probably null Het
Pkd1l3 G A 8: 109,623,663 S380N probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plpp2 C T 10: 79,527,580 R77K probably damaging Het
Pym1 G T 10: 128,765,984 R168L possibly damaging Het
Rnf207 A G 4: 152,315,779 C175R probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Speg T C 1: 75,430,937 V3196A probably damaging Het
Syne1 T A 10: 5,348,943 I1048L possibly damaging Het
Th T C 7: 142,896,041 E41G probably damaging Het
Tmx4 T A 2: 134,598,526 *336L probably null Het
Tnfrsf18 T C 4: 156,026,415 V10A possibly damaging Het
Tnxb A T 17: 34,716,984 I2670F probably damaging Het
Tpx2 T C 2: 152,890,492 V562A probably damaging Het
Vmn2r73 A G 7: 85,871,789 S324P probably benign Het
Vps18 T C 2: 119,297,365 Y890H probably benign Het
Ythdc1 G A 5: 86,835,705 D670N probably damaging Het
Other mutations in Rbm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2093:Rbm4 UTSW 19 4787764 missense probably damaging 0.99
R3693:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3694:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3695:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R6103:Rbm4 UTSW 19 4787919 missense probably damaging 0.98
R7598:Rbm4 UTSW 19 4792511 missense possibly damaging 0.73
R7810:Rbm4 UTSW 19 4792622 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTAAAAGGCTGAGTACCGCGCCC -3'
(R):5'- GTGATAGCAACCCTTCTTGCGTCTG -3'

Sequencing Primer
(F):5'- GCCCGATCCGCATACTG -3'
(R):5'- AGAGTGTCCAATAGATCGTTCG -3'
Posted On2013-04-16