Incidental Mutation 'R2853:Arhgap23'
ID252417
Institutional Source Beutler Lab
Gene Symbol Arhgap23
Ensembl Gene ENSMUSG00000049807
Gene NameRho GTPase activating protein 23
Synonyms
MMRRC Submission 040446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2853 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97415533-97502402 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 97492594 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056955] [ENSMUST00000093940] [ENSMUST00000107601] [ENSMUST00000121799] [ENSMUST00000142465]
Predicted Effect probably null
Transcript: ENSMUST00000056955
SMART Domains Protein: ENSMUSP00000060323
Gene: ENSMUSG00000047988

DomainStartEndE-ValueType
low complexity region 77 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093940
SMART Domains Protein: ENSMUSP00000091472
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
Blast:RhoGAP 72 123 3e-6 BLAST
low complexity region 149 162 N/A INTRINSIC
low complexity region 173 194 N/A INTRINSIC
low complexity region 224 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107601
SMART Domains Protein: ENSMUSP00000103227
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 246 258 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 426 443 N/A INTRINSIC
PH 479 600 3.2e-12 SMART
low complexity region 679 687 N/A INTRINSIC
RhoGAP 707 884 6.83e-65 SMART
low complexity region 1051 1066 N/A INTRINSIC
low complexity region 1101 1114 N/A INTRINSIC
low complexity region 1125 1146 N/A INTRINSIC
low complexity region 1176 1194 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121799
SMART Domains Protein: ENSMUSP00000112999
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
PDZ 52 160 4.2e-17 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 565 580 N/A INTRINSIC
low complexity region 637 654 N/A INTRINSIC
PH 690 811 3.2e-12 SMART
low complexity region 890 898 N/A INTRINSIC
RhoGAP 918 1095 6.83e-65 SMART
low complexity region 1262 1277 N/A INTRINSIC
low complexity region 1312 1325 N/A INTRINSIC
low complexity region 1336 1357 N/A INTRINSIC
low complexity region 1387 1405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142465
SMART Domains Protein: ENSMUSP00000123191
Gene: ENSMUSG00000049807

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
PH 179 300 3.2e-12 SMART
low complexity region 379 387 N/A INTRINSIC
RhoGAP 407 584 6.83e-65 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RHO (see ARHA; MIM 165390) family of small GTPases are involved in signal transduction through transmembrane receptors, and they are inactive in the GDP-bound form and active in the GTP-bound form. GTPase-activating proteins, such as ARHGAP23, inactivate RHO family proteins by stimulating their hydrolysis of GTP (Katoh and Katoh, 2004 [PubMed 15254754]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A C 16: 8,600,968 K142T probably damaging Het
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Angptl7 T C 4: 148,500,279 E4G probably benign Het
Aph1c T C 9: 66,834,482 probably null Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Chchd1 T C 14: 20,704,220 S67P probably benign Het
Cubn C T 2: 13,430,834 V1104I probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Fam214b A G 4: 43,036,293 L146P probably benign Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Ids G T X: 70,353,170 T329K probably damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Megf10 T C 18: 57,293,931 I1107T probably damaging Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mtm1 T G X: 71,301,783 I437S probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ncs1 T C 2: 31,287,317 F169L probably damaging Het
Ndst2 T C 14: 20,729,896 E92G probably damaging Het
Parm1 T C 5: 91,594,265 V164A probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Scgb1b20 A C 7: 33,373,524 K52N possibly damaging Het
Setbp1 T A 18: 78,923,996 Q171L probably benign Het
Sik2 A T 9: 50,898,297 L612Q probably damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Ss18l1 A G 2: 180,058,121 Y258C probably damaging Het
Togaram1 A G 12: 65,016,612 K1567R probably benign Het
Ttc6 T C 12: 57,576,181 F122S probably damaging Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 T C 4: 103,050,158 I644V possibly damaging Het
Other mutations in Arhgap23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgap23 APN 11 97492671 intron probably benign
IGL00493:Arhgap23 APN 11 97446553 critical splice donor site probably null
IGL01729:Arhgap23 APN 11 97453961 missense probably damaging 1.00
IGL01805:Arhgap23 APN 11 97492602 intron probably benign
IGL02005:Arhgap23 APN 11 97491219 missense probably damaging 0.99
IGL02026:Arhgap23 APN 11 97451581 missense probably damaging 0.99
IGL02135:Arhgap23 APN 11 97451702 missense probably damaging 0.97
IGL02178:Arhgap23 APN 11 97452353 missense probably benign 0.42
IGL02226:Arhgap23 APN 11 97451600 missense probably benign 0.07
IGL02309:Arhgap23 APN 11 97466001 splice site probably benign
IGL02399:Arhgap23 APN 11 97491005 intron probably benign
IGL02630:Arhgap23 APN 11 97454297 missense probably benign 0.24
IGL02724:Arhgap23 APN 11 97491179 missense probably damaging 0.99
IGL02740:Arhgap23 APN 11 97475017 missense probably damaging 1.00
IGL02746:Arhgap23 APN 11 97454204 splice site probably benign
IGL02862:Arhgap23 APN 11 97456480 missense probably damaging 1.00
IGL03380:Arhgap23 APN 11 97452518 missense probably damaging 1.00
R0091:Arhgap23 UTSW 11 97452244 missense probably benign 0.44
R0134:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0225:Arhgap23 UTSW 11 97444328 missense probably benign 0.09
R0305:Arhgap23 UTSW 11 97501109 missense probably damaging 0.99
R0358:Arhgap23 UTSW 11 97463588 missense probably damaging 1.00
R0422:Arhgap23 UTSW 11 97463652 missense probably damaging 1.00
R0497:Arhgap23 UTSW 11 97452163 missense probably damaging 1.00
R0580:Arhgap23 UTSW 11 97446536 frame shift probably null
R0782:Arhgap23 UTSW 11 97500554 missense possibly damaging 0.73
R1216:Arhgap23 UTSW 11 97492672 intron probably benign
R1488:Arhgap23 UTSW 11 97500859 missense possibly damaging 0.53
R1785:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R1844:Arhgap23 UTSW 11 97463408 missense probably damaging 1.00
R1855:Arhgap23 UTSW 11 97448697 missense probably damaging 0.99
R1977:Arhgap23 UTSW 11 97451447 missense possibly damaging 0.95
R2064:Arhgap23 UTSW 11 97493062 missense probably benign 0.02
R2130:Arhgap23 UTSW 11 97451561 missense possibly damaging 0.77
R2431:Arhgap23 UTSW 11 97452404 missense probably benign
R3767:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3768:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3769:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R3770:Arhgap23 UTSW 11 97476106 missense probably damaging 1.00
R4209:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R4247:Arhgap23 UTSW 11 97463699 missense probably damaging 1.00
R4997:Arhgap23 UTSW 11 97452020 missense probably damaging 0.98
R5399:Arhgap23 UTSW 11 97500917 missense probably damaging 0.97
R5549:Arhgap23 UTSW 11 97466568 missense probably damaging 0.96
R5655:Arhgap23 UTSW 11 97452546 critical splice donor site probably null
R5857:Arhgap23 UTSW 11 97451579 missense possibly damaging 0.93
R6013:Arhgap23 UTSW 11 97500992 missense probably damaging 0.99
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6031:Arhgap23 UTSW 11 97476139 missense probably damaging 1.00
R6077:Arhgap23 UTSW 11 97491232 critical splice donor site probably null
R6151:Arhgap23 UTSW 11 97500412 missense probably benign 0.01
R6393:Arhgap23 UTSW 11 97463672 missense probably damaging 0.98
R6693:Arhgap23 UTSW 11 97466517 missense probably damaging 1.00
R6752:Arhgap23 UTSW 11 97452248 missense probably damaging 0.98
R7202:Arhgap23 UTSW 11 97451993 missense possibly damaging 0.65
R7209:Arhgap23 UTSW 11 97476085 missense probably damaging 1.00
R7209:Arhgap23 UTSW 11 97492447 splice site probably null
R7320:Arhgap23 UTSW 11 97451545 missense probably benign 0.10
R7345:Arhgap23 UTSW 11 97466478 missense possibly damaging 0.91
R7599:Arhgap23 UTSW 11 97500343 missense probably benign
R8229:Arhgap23 UTSW 11 97453906 missense probably benign 0.36
R8412:Arhgap23 UTSW 11 97466028 missense probably benign 0.02
R8460:Arhgap23 UTSW 11 97452371 missense probably damaging 1.00
R8492:Arhgap23 UTSW 11 97475021 missense probably damaging 1.00
R8525:Arhgap23 UTSW 11 97490084 missense probably damaging 1.00
R8692:Arhgap23 UTSW 11 97454496 missense probably damaging 0.99
R8708:Arhgap23 UTSW 11 97452412 missense probably benign 0.06
R8749:Arhgap23 UTSW 11 97500815 missense probably damaging 0.99
R8882:Arhgap23 UTSW 11 97465123 missense probably benign 0.00
RF020:Arhgap23 UTSW 11 97463561 missense probably damaging 1.00
V8831:Arhgap23 UTSW 11 97456545 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTTGAACCAACCTGCTCCC -3'
(R):5'- CCATGACACTGAAGCACTGG -3'

Sequencing Primer
(F):5'- GCACTGCCAGGCCTTGTTATC -3'
(R):5'- CACTGGAGAGAAAATGCCAGTTTC -3'
Posted On2014-12-04