Incidental Mutation 'R2570:Tbl3'
ID252432
Institutional Source Beutler Lab
Gene Symbol Tbl3
Ensembl Gene ENSMUSG00000040688
Gene Nametransducin (beta)-like 3
Synonyms
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.971) question?
Stock #R2570 (G1)
Quality Score176
Status Not validated
Chromosome17
Chromosomal Location24697949-24707660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24703316 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 405 (M405K)
Ref Sequence ENSEMBL: ENSMUSP00000120911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019464] [ENSMUST00000126319]
Predicted Effect probably benign
Transcript: ENSMUST00000019464
SMART Domains Protein: ENSMUSP00000019464
Gene: ENSMUSG00000019320

DomainStartEndE-ValueType
PX 6 122 1.36e-2 SMART
SH3 160 218 1.55e0 SMART
SH3 234 289 1.8e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046534
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124864
Predicted Effect possibly damaging
Transcript: ENSMUST00000126319
AA Change: M405K

PolyPhen 2 Score 0.468 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120911
Gene: ENSMUSG00000040688
AA Change: M405K

DomainStartEndE-ValueType
WD40 54 94 3.08e0 SMART
WD40 97 137 2.38e-6 SMART
WD40 140 181 3.85e-1 SMART
WD40 184 223 6.94e-8 SMART
WD40 237 275 7.36e1 SMART
WD40 278 320 3.07e1 SMART
WD40 323 363 1.78e0 SMART
WD40 365 404 1.17e-5 SMART
WD40 410 450 8.16e-5 SMART
WD40 468 507 5.18e-7 SMART
WD40 510 549 8.1e-9 SMART
WD40 552 591 8.55e-8 SMART
WD40 594 633 2.93e-6 SMART
low complexity region 637 650 N/A INTRINSIC
Pfam:Utp13 654 788 3.7e-43 PFAM
low complexity region 792 800 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126342
Predicted Effect probably benign
Transcript: ENSMUST00000130633
SMART Domains Protein: ENSMUSP00000117818
Gene: ENSMUSG00000040688

DomainStartEndE-ValueType
WD40 2 38 8.75e-5 SMART
WD40 41 80 8.1e-9 SMART
WD40 90 129 9.52e-6 SMART
WD40 132 171 2.93e-6 SMART
low complexity region 175 188 N/A INTRINSIC
Pfam:Utp13 192 299 1e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149326
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152527
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has sequence similarity with members of the WD40 repeat-containing protein family. The WD40 group is a large family of proteins, which appear to have a regulatory function. It is believed that the WD40 repeats mediate protein-protein interactions and members of the family are involved in signal transduction, RNA processing, gene regulation, vesicular trafficking, cytoskeletal assembly and may play a role in the control of cytotypic differentiation. This gene has multiple polyadenylation sites. It might have multiple alternatively spliced transcript variants but the variants have not been fully described yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Cdk12 T G 11: 98,203,792 M142R possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Dhcr24 T C 4: 106,585,832 F355L probably benign Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Olfr693 A G 7: 106,677,667 I273T probably benign Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Stradb C T 1: 58,988,584 T91I probably damaging Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tmem132a A T 19: 10,859,742 L612Q probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Tbl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Tbl3 APN 17 24701905 splice site probably benign
IGL01092:Tbl3 APN 17 24705252 missense probably damaging 1.00
IGL01601:Tbl3 APN 17 24702317 missense probably damaging 1.00
IGL01610:Tbl3 APN 17 24704044 missense probably damaging 1.00
IGL02214:Tbl3 APN 17 24704132 unclassified probably benign
IGL03027:Tbl3 APN 17 24701193 critical splice acceptor site probably null
FR4449:Tbl3 UTSW 17 24702544 unclassified probably benign
R0230:Tbl3 UTSW 17 24701333 missense probably damaging 1.00
R0288:Tbl3 UTSW 17 24701807 missense probably damaging 1.00
R0305:Tbl3 UTSW 17 24705461 missense probably damaging 1.00
R1104:Tbl3 UTSW 17 24701606 missense probably benign 0.02
R1920:Tbl3 UTSW 17 24704503 missense probably benign 0.04
R2513:Tbl3 UTSW 17 24704550 critical splice acceptor site probably null
R2851:Tbl3 UTSW 17 24702583 missense probably damaging 1.00
R3905:Tbl3 UTSW 17 24702032 missense probably damaging 1.00
R3944:Tbl3 UTSW 17 24700708 missense possibly damaging 0.94
R4019:Tbl3 UTSW 17 24704721 missense probably damaging 0.98
R4745:Tbl3 UTSW 17 24705330 unclassified probably benign
R5288:Tbl3 UTSW 17 24705970 missense possibly damaging 0.88
R5605:Tbl3 UTSW 17 24700759 missense probably benign 0.06
R5791:Tbl3 UTSW 17 24704434 missense probably damaging 0.99
R6236:Tbl3 UTSW 17 24700743 missense probably benign 0.12
R6302:Tbl3 UTSW 17 24704671 missense probably benign 0.05
R6938:Tbl3 UTSW 17 24705213 missense possibly damaging 0.61
R7173:Tbl3 UTSW 17 24705259 missense probably benign
R7176:Tbl3 UTSW 17 24700758 missense probably benign 0.01
R7382:Tbl3 UTSW 17 24705291 missense probably benign 0.21
R7555:Tbl3 UTSW 17 24701976 critical splice donor site probably null
R7732:Tbl3 UTSW 17 24704162 missense probably benign 0.00
R7780:Tbl3 UTSW 17 24702231 missense probably damaging 1.00
R7899:Tbl3 UTSW 17 24702484 missense probably damaging 1.00
R8108:Tbl3 UTSW 17 24700916 missense probably benign
RF005:Tbl3 UTSW 17 24702541 unclassified probably benign
X0022:Tbl3 UTSW 17 24705573 nonsense probably null
X0028:Tbl3 UTSW 17 24702321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGCCAAATGAGCACACTC -3'
(R):5'- CCAAGGCAAGAAAACTATGACTC -3'

Sequencing Primer
(F):5'- CATTCTCTACCCTGTGCTAGAAG -3'
(R):5'- GGTCTGAAGTTCAAATCCCAGC -3'
Posted On2014-12-04