Incidental Mutation 'R2853:Setbp1'
ID 252438
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission 040446-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.539) question?
Stock # R2853 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 78750380-79109391 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78923996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 171 (Q171L)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: Q171L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: Q171L

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161465
AA Change: Q171L

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: Q171L

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Meta Mutation Damage Score 0.0961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abat A C 16: 8,600,968 K142T probably damaging Het
Als2cl T C 9: 110,894,135 S636P probably damaging Het
Angptl7 T C 4: 148,500,279 E4G probably benign Het
Aph1c T C 9: 66,834,482 probably null Het
Arhgap23 T C 11: 97,492,594 probably null Het
Arhgef4 A C 1: 34,724,048 D795A unknown Het
Ccdc85a A G 11: 28,392,942 probably benign Het
Chchd1 T C 14: 20,704,220 S67P probably benign Het
Cubn C T 2: 13,430,834 V1104I probably benign Het
Dennd5a A T 7: 109,933,671 N297K probably damaging Het
Egflam A T 15: 7,219,701 W879R probably damaging Het
Fam214b A G 4: 43,036,293 L146P probably benign Het
Far1 T C 7: 113,553,737 Y351H possibly damaging Het
Gpr62 T C 9: 106,464,712 E339G probably benign Het
Hspd1 A T 1: 55,081,097 D315E probably damaging Het
Ids G T X: 70,353,170 T329K probably damaging Het
Itga9 G A 9: 118,636,536 E153K probably damaging Het
Krt82 T C 15: 101,548,435 Y170C probably damaging Het
Megf10 T C 18: 57,293,931 I1107T probably damaging Het
Mre11a A G 9: 14,826,547 E599G probably benign Het
Mtm1 T G X: 71,301,783 I437S probably damaging Het
Ncoa2 C T 1: 13,186,889 V129I probably damaging Het
Ncs1 T C 2: 31,287,317 F169L probably damaging Het
Ndst2 T C 14: 20,729,896 E92G probably damaging Het
Parm1 T C 5: 91,594,265 V164A probably benign Het
Pkhd1 T C 1: 20,058,302 Q4059R probably benign Het
Scgb1b20 A C 7: 33,373,524 K52N possibly damaging Het
Sik2 A T 9: 50,898,297 L612Q probably damaging Het
Srprb G A 9: 103,198,839 Q800* probably null Het
Ss18l1 A G 2: 180,058,121 Y258C probably damaging Het
Togaram1 A G 12: 65,016,612 K1567R probably benign Het
Ttc6 T C 12: 57,576,181 F122S probably damaging Het
Vmn2r85 T A 10: 130,419,166 M550L probably benign Het
Wdr78 T C 4: 103,050,158 I644V possibly damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 splice site probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R8147:Setbp1 UTSW 18 78856800 missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78857383 missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78857756 missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78858754 missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78783327 missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78858301 missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78856508 missense probably benign 0.00
R8983:Setbp1 UTSW 18 78859244 missense probably benign 0.37
R9062:Setbp1 UTSW 18 78857051 missense probably benign 0.01
R9113:Setbp1 UTSW 18 78857733 missense probably damaging 0.99
R9364:Setbp1 UTSW 18 78783384 missense probably benign 0.00
R9513:Setbp1 UTSW 18 78856566 missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78858107 missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78859414 missense probably benign 0.07
R9554:Setbp1 UTSW 18 78783384 missense probably benign 0.00
R9680:Setbp1 UTSW 18 78859283 missense probably benign
R9711:Setbp1 UTSW 18 78856927 missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTCAAAGTCCTGACTAAAATGGC -3'
(R):5'- AGGAAAGTCTGGCTTCCTCG -3'

Sequencing Primer
(F):5'- AGTCCTGACTAAAATGGCTTTTG -3'
(R):5'- AAAGTCTGGCTTCCTCGTGTTTTG -3'
Posted On 2014-12-04