Incidental Mutation 'R2570:Tmem132a'
ID252452
Institutional Source Beutler Lab
Gene Symbol Tmem132a
Ensembl Gene ENSMUSG00000024736
Gene Nametransmembrane protein 132A
SynonymsHspa5bp1, 6720481D13Rik
MMRRC Submission 040428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2570 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10857822-10869940 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10859742 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 612 (L612Q)
Ref Sequence ENSEMBL: ENSMUSP00000025645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025645] [ENSMUST00000025646] [ENSMUST00000120524]
Predicted Effect probably null
Transcript: ENSMUST00000025645
AA Change: L612Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025645
Gene: ENSMUSG00000024736
AA Change: L612Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:TMEM132D_N 44 167 1.6e-35 PFAM
low complexity region 206 223 N/A INTRINSIC
Pfam:TMEM132 403 745 4.1e-108 PFAM
low complexity region 759 776 N/A INTRINSIC
Pfam:TMEM132D_C 809 897 1.5e-31 PFAM
low complexity region 906 923 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 960 976 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025646
SMART Domains Protein: ENSMUSP00000025646
Gene: ENSMUSG00000024737

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Pfam:MFS_1 38 508 3.4e-10 PFAM
Pfam:PTR2 101 519 3.2e-79 PFAM
transmembrane domain 538 557 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120524
AA Change: L612Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113696
Gene: ENSMUSG00000024736
AA Change: L612Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138263
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly similar to the rat Grp78-binding protein (GBP). Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,630,204 N763I probably damaging Het
Actr8 T C 14: 29,987,282 V281A probably damaging Het
Adam1b A T 5: 121,501,748 N411K probably damaging Het
Adamdec1 T A 14: 68,579,208 Q77L probably damaging Het
Adgre4 T A 17: 55,778,878 F59Y possibly damaging Het
Akr1c18 T C 13: 4,142,164 N178S probably benign Het
Aldh1a7 T A 19: 20,699,956 T434S probably benign Het
B020004J07Rik T C 4: 101,837,246 T147A probably benign Het
BC067074 C T 13: 113,318,587 T389I probably benign Het
Bcl10 T A 3: 145,933,030 N142K probably benign Het
C1qc T C 4: 136,890,091 I231M probably benign Het
Cacna1b A T 2: 24,606,637 L2307* probably null Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Cdc42bpa G A 1: 180,150,177 R1518Q possibly damaging Het
Cdk12 T G 11: 98,203,792 M142R possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2c50 C G 19: 40,090,320 H90D probably benign Het
Dach1 A G 14: 97,901,411 M480T probably benign Het
Dennd1a A T 2: 37,844,783 F57L probably damaging Het
Dhcr24 T C 4: 106,585,832 F355L probably benign Het
Drc1 A G 5: 30,355,265 R339G probably damaging Het
Efna5 A T 17: 62,881,028 Y35N probably benign Het
Ehmt1 A G 2: 24,815,741 V811A probably damaging Het
Fam135a A T 1: 24,021,964 V1114E probably damaging Het
Frmd8 C A 19: 5,874,712 R28L probably damaging Het
Gm11639 T A 11: 104,733,664 S840R probably damaging Het
Gm9936 A G 5: 114,857,544 probably benign Het
Hgsnat C T 8: 25,945,252 W618* probably null Het
Itgal T C 7: 127,314,096 F622L probably damaging Het
Kalrn C T 16: 34,310,495 E451K probably damaging Het
Kat2a A T 11: 100,710,822 F256I probably damaging Het
Lama4 A T 10: 39,075,358 D1033V possibly damaging Het
Lama4 T A 10: 39,106,047 D1757E probably damaging Het
Laptm5 T C 4: 130,932,047 Y212H probably damaging Het
Lsm10 T C 4: 126,097,923 L24P probably damaging Het
Mtfp1 T C 11: 4,094,504 E27G probably damaging Het
Ncaph2 C A 15: 89,370,475 D399E probably benign Het
Ncor2 T C 5: 125,028,800 probably null Het
Nek9 A C 12: 85,332,546 Y195* probably null Het
Npas1 T C 7: 16,474,703 D83G probably damaging Het
Nrsn2 A T 2: 152,369,821 F97I possibly damaging Het
Oas1c T C 5: 120,805,438 N10S probably benign Het
Olfr545 T C 7: 102,493,899 N292S probably damaging Het
Olfr58 T A 9: 19,784,009 L292Q probably damaging Het
Olfr693 A G 7: 106,677,667 I273T probably benign Het
Pcdha4 A T 18: 36,953,612 T283S probably benign Het
Pdk1 A C 2: 71,873,560 D64A possibly damaging Het
Ptpdc1 C T 13: 48,586,063 A631T probably benign Het
Rasal2 G T 1: 157,161,300 A660E possibly damaging Het
Sgpp2 T A 1: 78,360,150 V55E possibly damaging Het
Shank2 A T 7: 144,068,770 I214F probably damaging Het
Slfn14 T C 11: 83,283,607 N186S probably benign Het
Soga3 A T 10: 29,146,765 Q36L possibly damaging Het
Sptbn5 A T 2: 120,048,640 noncoding transcript Het
Stradb C T 1: 58,988,584 T91I probably damaging Het
Sulf2 T C 2: 166,085,801 I359V probably benign Het
Tbl3 A T 17: 24,703,316 M405K possibly damaging Het
Tecta G T 9: 42,332,552 D2001E probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Tgfbi T A 13: 56,638,708 probably null Het
Tnf T C 17: 35,200,500 N102S probably damaging Het
Trib3 A T 2: 152,343,236 V31D probably benign Het
Ube2q2 T A 9: 55,191,856 F248L probably benign Het
Usf3 T C 16: 44,216,381 V408A probably benign Het
Vmn1r159 T C 7: 22,842,882 M242V probably benign Het
Vmn2r105 A T 17: 20,227,323 L413H probably damaging Het
Zbtb2 T G 10: 4,368,673 N451T probably damaging Het
Zfp593 C A 4: 134,245,558 probably benign Het
Other mutations in Tmem132a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Tmem132a APN 19 10861524 splice site probably benign
IGL02508:Tmem132a APN 19 10858518 missense probably damaging 1.00
R0514:Tmem132a UTSW 19 10858991 missense probably damaging 0.99
R0918:Tmem132a UTSW 19 10858113 missense probably damaging 1.00
R1160:Tmem132a UTSW 19 10858574 missense probably damaging 0.98
R1205:Tmem132a UTSW 19 10859084 missense probably benign 0.03
R1619:Tmem132a UTSW 19 10861698 missense probably damaging 1.00
R1777:Tmem132a UTSW 19 10858506 missense probably damaging 1.00
R1815:Tmem132a UTSW 19 10861567 nonsense probably null
R1869:Tmem132a UTSW 19 10858688 missense possibly damaging 0.48
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R1888:Tmem132a UTSW 19 10863499 missense probably damaging 1.00
R2133:Tmem132a UTSW 19 10864066 missense probably benign 0.26
R2441:Tmem132a UTSW 19 10860137 missense probably damaging 0.96
R3157:Tmem132a UTSW 19 10859537 nonsense probably null
R3159:Tmem132a UTSW 19 10859537 nonsense probably null
R4152:Tmem132a UTSW 19 10859063 missense probably benign 0.04
R4281:Tmem132a UTSW 19 10861726 missense possibly damaging 0.81
R4547:Tmem132a UTSW 19 10860200 missense possibly damaging 0.83
R4793:Tmem132a UTSW 19 10865493 missense probably damaging 1.00
R4947:Tmem132a UTSW 19 10866934 missense possibly damaging 0.90
R4998:Tmem132a UTSW 19 10858941 missense probably benign 0.02
R5226:Tmem132a UTSW 19 10867144 missense possibly damaging 0.50
R5323:Tmem132a UTSW 19 10864007 missense possibly damaging 0.81
R6659:Tmem132a UTSW 19 10860321 missense probably damaging 0.99
R6814:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R6872:Tmem132a UTSW 19 10863305 missense probably damaging 1.00
R7205:Tmem132a UTSW 19 10866931 missense probably damaging 1.00
R7383:Tmem132a UTSW 19 10866994 missense probably benign 0.01
R7505:Tmem132a UTSW 19 10858673 missense probably damaging 1.00
R7513:Tmem132a UTSW 19 10860128 missense probably damaging 0.98
R7595:Tmem132a UTSW 19 10858205 missense probably damaging 1.00
Z1088:Tmem132a UTSW 19 10858935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCAAGCGGTCCACATAC -3'
(R):5'- TAGGTGTGAAGGCTGCAGAC -3'

Sequencing Primer
(F):5'- ATCACCTGCTTTGGGGC -3'
(R):5'- AGACGGGGCTTACTGTGAC -3'
Posted On2014-12-04