Mutagenetix > Incidental Mutations

Incidental Mutation 'R2571:Cntnap5a'

252465

Institutional Source

Beutler Lab

Gene Symbol

Cntnap5a

Ensembl Gene

ENSMUSG00000070695

Gene Name

contactin associated protein-like 5A

Synonyms

Caspr5-1

MMRRC Submission

040429-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2571 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115684756-116587323 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 116184362 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 461 (R461C)

Ref Sequence

ENSEMBL: ENSMUSP00000035732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043725]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043725
AA Change: R461C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000035732
Gene: ENSMUSG00000070695
AA Change: R461C

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
FA58C	33	174	1.63e-13	SMART
LamG	201	338	1.4e-26	SMART
LamG	388	522	1.5e-26	SMART
EGF	550	584	2.16e-1	SMART
Blast:FBG	587	772	2e-81	BLAST
LamG	812	939	1.54e-28	SMART
EGF	960	996	2.28e0	SMART
LamG	1037	1173	4.73e-15	SMART
transmembrane domain	1241	1263	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the neurexin family, members of which function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,249,885	N2438S	probably benign	Het
Ago3	G	A	4: 126,363,811	R476W	probably damaging	Het
Akap8	T	C	17: 32,315,455	E339G	probably damaging	Het
Apba2	T	C	7: 64,745,750	V658A	probably damaging	Het
BC049730	A	G	7: 24,713,394	I76V	probably benign	Het
Bcl3	T	C	7: 19,809,527	D338G	probably damaging	Het
Ccdc138	T	C	10: 58,513,222	Y197H	probably benign	Het
Ccdc162	T	A	10: 41,552,397	Q499L	probably damaging	Het
Ccser1	G	A	6: 61,422,960	C21Y	probably damaging	Het
Chil6	A	T	3: 106,390,393	Y229*	probably null	Het
Col19a1	T	A	1: 24,374,631	R407S	unknown	Het
Crlf3	A	T	11: 80,047,513	F433I	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Dnah10	A	T	5: 124,775,478	R1867W	probably damaging	Het
Dsg3	T	C	18: 20,540,005	V911A	probably benign	Het
Dzip3	T	C	16: 48,972,218		probably null	Het
Evpl	T	C	11: 116,237,969	Q10R	unknown	Het
Glra3	C	T	8: 56,110,481	A337V	probably benign	Het
Gm8909	C	T	17: 36,167,661	G132R	possibly damaging	Het
Hcfc2	T	C	10: 82,709,023	F163S	probably damaging	Het
Hells	T	C	19: 38,959,733	V701A	possibly damaging	Het
Helz	A	G	11: 107,613,952	T422A	probably benign	Het
Hhat	G	A	1: 192,553,022	T442I	probably damaging	Het
Hmces	A	T	6: 87,936,220	Q319L	possibly damaging	Het
Ighv1-62-1	T	A	12: 115,386,757	T97S	probably damaging	Het
Impad1	C	T	4: 4,778,192		probably null	Het
Kcne2	C	T	16: 92,296,912	T109I	probably damaging	Het
Kcnq1	T	G	7: 143,107,696	L113R	probably benign	Het
Kdm5d	T	C	Y: 940,932	S1106P	probably benign	Het
Kel	C	A	6: 41,688,067	A588S	possibly damaging	Het
Kmt2e	T	A	5: 23,501,887	F1483I	probably benign	Het
Krt4	T	A	15: 101,921,257	N279Y	probably damaging	Het
Lama4	T	A	10: 39,042,675	M384K	possibly damaging	Het
Lepr	C	T	4: 101,768,172	T508I	possibly damaging	Het
Map1lc3b	T	A	8: 121,593,474		probably null	Het
Me1	T	C	9: 86,654,698	H108R	probably damaging	Het
Mindy4	T	C	6: 55,284,785	S560P	probably damaging	Het
Mmp3	T	A	9: 7,451,844	I394N	possibly damaging	Het
Mmrn2	T	C	14: 34,402,939	S826P	probably damaging	Het
Olfr702	T	A	7: 106,823,726	M267L	probably benign	Het
Osbpl7	T	C	11: 97,054,841	L138P	probably damaging	Het
Pcdhga11	G	A	18: 37,756,868	E310K	probably damaging	Het
Pcif1	A	G	2: 164,884,211	D39G	probably damaging	Het
Ppp1r21	C	T	17: 88,545,382	T63I	probably benign	Het
Prickle2	T	C	6: 92,705,400	Q25R	probably benign	Het
Ptk2	A	G	15: 73,231,919	L94P	probably damaging	Het
Ptprg	T	C	14: 12,122,135	F333S	probably benign	Het
Rag2	T	A	2: 101,629,967	H207Q	probably damaging	Het
Rps6ka1	G	T	4: 133,860,612		probably null	Het
Rps6ka4	G	T	19: 6,838,103	H174Q	probably damaging	Het
Rreb1	C	A	13: 37,899,637	T92K	probably damaging	Het
Ryr1	T	A	7: 29,036,126	M4076L	possibly damaging	Het
Ryr1	A	T	7: 29,009,562	M4793K	unknown	Het
Sec16a	A	C	2: 26,439,331	S891A	probably benign	Het
Sgsh	A	G	11: 119,350,514	Y132H	probably damaging	Het
Sos2	T	A	12: 69,635,718	E242V	possibly damaging	Het
Spata31d1c	G	T	13: 65,036,384	R580L	probably damaging	Het
Spata9	C	A	13: 75,967,761		probably benign	Het
Tead2	T	A	7: 45,225,770	V202E	probably damaging	Het
Thada	T	C	17: 84,454,640	K168E	probably damaging	Het
Tmem64	T	C	4: 15,266,718	I256T	probably damaging	Het
Tra2a	G	T	6: 49,252,487		probably benign	Het
Trim30a	T	A	7: 104,429,326	N181I	possibly damaging	Het
Ttc13	A	C	8: 124,683,799	Y372D	probably damaging	Het
Vit	T	C	17: 78,586,745	V192A	probably benign	Het
Vmn2r69	T	C	7: 85,415,556	T41A	probably benign	Het
Vps13d	C	A	4: 145,149,136	K1600N	probably benign	Het
Xpnpep3	A	T	15: 81,450,926	H420L	probably damaging	Het
Zfp322a	A	G	13: 23,356,444	L376P	probably damaging	Het
Zfp619	T	C	7: 39,537,171	L875P	probably damaging	Het
Zic5	T	A	14: 122,459,478	Q575L	unknown	Het

Other mutations in Cntnap5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00763:Cntnap5a	APN	1	116117677	missense	possibly damaging	0.48
IGL00929:Cntnap5a	APN	1	116060274	splice site	probably null
IGL00959:Cntnap5a	APN	1	116184327	missense	probably benign	0.00
IGL01721:Cntnap5a	APN	1	116157637	missense	probably benign
IGL02009:Cntnap5a	APN	1	116157494	missense	probably benign	0.15
IGL02111:Cntnap5a	APN	1	116089352	missense	probably benign	0.00
IGL02198:Cntnap5a	APN	1	116580532	missense	probably benign
IGL02751:Cntnap5a	APN	1	116184457	critical splice donor site	probably null
IGL02752:Cntnap5a	APN	1	116580531	missense	probably benign	0.00
IGL02989:Cntnap5a	APN	1	116412083	splice site	probably benign
IGL03195:Cntnap5a	APN	1	116157448	missense	probably benign	0.00
PIT4142001:Cntnap5a	UTSW	1	115684956	start gained	probably benign
R0294:Cntnap5a	UTSW	1	115915316	missense	probably benign
R0377:Cntnap5a	UTSW	1	116292529	missense	probably benign	0.04
R0597:Cntnap5a	UTSW	1	116184461	splice site	probably benign
R0616:Cntnap5a	UTSW	1	116580549	missense	possibly damaging	0.80
R0725:Cntnap5a	UTSW	1	116292476	missense	probably benign	0.25
R0842:Cntnap5a	UTSW	1	116442223	missense	probably damaging	0.96
R1103:Cntnap5a	UTSW	1	116580669	missense	possibly damaging	0.81
R1265:Cntnap5a	UTSW	1	116428518	missense	possibly damaging	0.49
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1467:Cntnap5a	UTSW	1	115685168	nonsense	probably null
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1470:Cntnap5a	UTSW	1	116259519	missense	probably damaging	1.00
R1474:Cntnap5a	UTSW	1	116442373	nonsense	probably null
R1476:Cntnap5a	UTSW	1	115901020	missense	probably damaging	1.00
R1481:Cntnap5a	UTSW	1	116117663	missense	probably damaging	1.00
R1512:Cntnap5a	UTSW	1	115900950	missense	probably benign
R1526:Cntnap5a	UTSW	1	116428477	missense	probably benign
R1589:Cntnap5a	UTSW	1	116060200	missense	possibly damaging	0.77
R1603:Cntnap5a	UTSW	1	116412101	missense	possibly damaging	0.80
R1728:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1728:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1729:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1729:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1730:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1730:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1739:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1739:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1762:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1762:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1783:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1783:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1785:Cntnap5a	UTSW	1	116455004	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455101	missense	probably benign	0.00
R1785:Cntnap5a	UTSW	1	116455143	missense	probably benign	0.01
R1816:Cntnap5a	UTSW	1	116428888	missense	probably benign	0.19
R1872:Cntnap5a	UTSW	1	116089210	missense	probably benign	0.02
R2095:Cntnap5a	UTSW	1	116442260	missense	probably damaging	1.00
R2113:Cntnap5a	UTSW	1	116188365	missense	probably damaging	0.98
R2144:Cntnap5a	UTSW	1	116101710	missense	probably benign	0.14
R2171:Cntnap5a	UTSW	1	116188402	missense	possibly damaging	0.95
R2219:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R2220:Cntnap5a	UTSW	1	116580639	missense	possibly damaging	0.83
R3019:Cntnap5a	UTSW	1	116101569	missense	probably benign
R3827:Cntnap5a	UTSW	1	116117679	missense	probably benign	0.14
R3870:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R3871:Cntnap5a	UTSW	1	116060249	missense	probably damaging	1.00
R4041:Cntnap5a	UTSW	1	116184399	missense	probably benign	0.00
R4080:Cntnap5a	UTSW	1	116101574	missense	probably benign	0.01
R4260:Cntnap5a	UTSW	1	116446595	missense	probably benign	0.31
R4685:Cntnap5a	UTSW	1	116446680	missense	possibly damaging	0.69
R4781:Cntnap5a	UTSW	1	116412201	missense	possibly damaging	0.88
R4785:Cntnap5a	UTSW	1	116101565	missense	probably benign	0.00
R5057:Cntnap5a	UTSW	1	115685213	missense	probably benign	0.10
R5059:Cntnap5a	UTSW	1	116428494	missense	probably benign	0.44
R5101:Cntnap5a	UTSW	1	116442296	missense	probably benign	0.00
R5302:Cntnap5a	UTSW	1	116157570	missense	probably benign	0.15
R5451:Cntnap5a	UTSW	1	115685143	missense	probably benign
R5473:Cntnap5a	UTSW	1	116089256	missense	probably benign	0.12
R5886:Cntnap5a	UTSW	1	116571672	critical splice donor site	probably null
R6311:Cntnap5a	UTSW	1	116412106	nonsense	probably null
R6464:Cntnap5a	UTSW	1	116184408	missense	probably benign
R6497:Cntnap5a	UTSW	1	116577897	missense	probably damaging	1.00
R6781:Cntnap5a	UTSW	1	116292397	missense	probably benign	0.05
R7137:Cntnap5a	UTSW	1	116089376	missense	probably damaging	1.00
R7290:Cntnap5a	UTSW	1	116221889	missense	probably damaging	1.00
R7342:Cntnap5a	UTSW	1	116060122	missense	probably benign	0.00
R7367:Cntnap5a	UTSW	1	116442295	missense	probably benign	0.00
R7373:Cntnap5a	UTSW	1	116580637	missense	probably benign	0.20
R7426:Cntnap5a	UTSW	1	116442380	missense	probably benign	0.03
R7444:Cntnap5a	UTSW	1	116292349	missense	probably benign
R7582:Cntnap5a	UTSW	1	116446632	missense	probably damaging	1.00
R7745:Cntnap5a	UTSW	1	116442283	missense	probably benign
R7948:Cntnap5a	UTSW	1	116580528	missense	probably benign	0.01
R7995:Cntnap5a	UTSW	1	116571547	missense	probably damaging	0.99
R8041:Cntnap5a	UTSW	1	116259479	missense	probably damaging	0.99
R8262:Cntnap5a	UTSW	1	116188410	missense	possibly damaging	0.66
R8273:Cntnap5a	UTSW	1	116571541	missense	probably damaging	1.00
R8320:Cntnap5a	UTSW	1	116446736	missense	possibly damaging	0.62
Z1088:Cntnap5a	UTSW	1	116060251	missense	probably benign	0.08
Z1176:Cntnap5a	UTSW	1	116428516	missense	probably damaging	1.00
Z1177:Cntnap5a	UTSW	1	116412168	missense	probably benign	0.03
Z1188:Cntnap5a	UTSW	1	116518205	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGGCAGAGATGTTCCACATATTTG -3'
(R):5'- TGCCTGAATATGCCTGCCTG -3'

Sequencing Primer
(F):5'- GATGTTCCACATATTTGATTTGTTCC -3'
(R):5'- TGCCTGCCTGCATGCATG -3'

Posted On

2014-12-04