Incidental Mutation 'R2571:Rag2'
List |< first << previous [record 49 of 72] next >> last >|
ID252471
Institutional Source Beutler Lab
Gene Symbol Rag2
Ensembl Gene ENSMUSG00000032864
Gene Namerecombination activating gene 2
SynonymsRag-2
MMRRC Submission 040429-MU
Accession Numbers

MGI:97849

Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location101624718-101632529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101629967 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 207 (H207Q)
Ref Sequence ENSEMBL: ENSMUSP00000106858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]
Predicted Effect probably damaging
Transcript: ENSMUST00000044031
AA Change: H207Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: H207Q

DomainStartEndE-ValueType
Pfam:RAG2 51 389 3.5e-179 PFAM
Pfam:RAG2_PHD 414 491 7.2e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099682
Predicted Effect probably damaging
Transcript: ENSMUST00000111227
AA Change: H207Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: H207Q

DomainStartEndE-ValueType
Pfam:RAG2 51 389 6.7e-193 PFAM
Pfam:RAG2_PHD 414 491 1.1e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111231
Predicted Effect probably benign
Transcript: ENSMUST00000128898
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Rag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00647:Rag2 APN 2 101630617 missense probably benign 0.00
IGL01358:Rag2 APN 2 101630020 missense possibly damaging 0.95
IGL01774:Rag2 APN 2 101630047 missense probably damaging 1.00
IGL02267:Rag2 APN 2 101630031 missense probably damaging 1.00
IGL02507:Rag2 APN 2 101630710 missense probably damaging 0.99
IGL02615:Rag2 APN 2 101629568 nonsense probably null
IGL02690:Rag2 APN 2 101629494 missense probably benign 0.00
IGL03087:Rag2 APN 2 101630214 missense probably benign 0.00
IGL03261:Rag2 APN 2 101630263 missense probably damaging 0.96
billfold UTSW 2 101630773 missense probably damaging 1.00
excambiar UTSW 2 101630776 missense probably damaging 0.99
snowcock UTSW 2 101630603 missense probably damaging 1.00
woodcock UTSW 2 101630119 missense probably damaging 0.98
R0266:Rag2 UTSW 2 101630603 missense probably damaging 1.00
R0284:Rag2 UTSW 2 101630119 missense probably damaging 0.98
R1250:Rag2 UTSW 2 101630439 missense probably damaging 0.96
R1520:Rag2 UTSW 2 101630131 missense probably damaging 0.99
R1641:Rag2 UTSW 2 101629615 missense probably benign 0.22
R2260:Rag2 UTSW 2 101630238 missense probably benign 0.00
R3441:Rag2 UTSW 2 101630300 missense probably damaging 0.99
R3752:Rag2 UTSW 2 101630776 missense probably damaging 0.99
R4894:Rag2 UTSW 2 101629677 missense probably damaging 1.00
R5197:Rag2 UTSW 2 101630740 missense probably damaging 1.00
R5236:Rag2 UTSW 2 101629660 missense probably damaging 1.00
R6815:Rag2 UTSW 2 101630555 missense probably damaging 0.99
R7365:Rag2 UTSW 2 101630773 missense probably damaging 1.00
X0027:Rag2 UTSW 2 101630373 missense probably damaging 1.00
Z31818:Rag2 UTSW 2 101630805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGAGATGTCCCTGAACCCAG -3'
(R):5'- GTGAGGATTGCACTGGAGAC -3'

Sequencing Primer
(F):5'- GATACGGCCATTCCATTGACGTG -3'
(R):5'- TGGAGACAGAGATTCCTCCTG -3'
Posted On2014-12-04