Incidental Mutation 'R2571:Impad1'
List |< first << previous [record 27 of 72] next >> last >|
ID252478
Institutional Source Beutler Lab
Gene Symbol Impad1
Ensembl Gene ENSMUSG00000066324
Gene Nameinositol monophosphatase domain containing 1
Synonyms1110001C20Rik, Jaws, gPAPP
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location4762484-4793355 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 4778192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084949]
Predicted Effect probably null
Transcript: ENSMUST00000084949
SMART Domains Protein: ENSMUSP00000082013
Gene: ENSMUSG00000066324

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Inositol_P 60 353 1.5e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol monophosphatase family. The encoded protein is localized to the Golgi apparatus and catalyzes the hydrolysis of phosphoadenosine phosphate (PAP) to adenosine monophosphate (AMP). Mutations in this gene are a cause of GRAPP type chondrodysplasia with joint dislocations, and a pseudogene of this gene is located on the long arm of chromosome 1. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants are neonatal lethal with growth retardation. Mutant embryo shows craniofacial abnormalities and shortened limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Impad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Impad1 APN 4 4776308 splice site probably benign
IGL02609:Impad1 APN 4 4767763 nonsense probably null
R1651:Impad1 UTSW 4 4792737 missense probably damaging 1.00
R4288:Impad1 UTSW 4 4778231 missense probably damaging 1.00
R4603:Impad1 UTSW 4 4767878 missense probably damaging 1.00
R5333:Impad1 UTSW 4 4767963 missense possibly damaging 0.92
R5365:Impad1 UTSW 4 4776385 missense probably damaging 1.00
R7275:Impad1 UTSW 4 4792962 missense probably damaging 0.98
R7599:Impad1 UTSW 4 4778207 missense probably damaging 1.00
R7756:Impad1 UTSW 4 4769385 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCTGGTGCTACTATTAAGTATC -3'
(R):5'- TCCCACTAGATAAATACTGAGGAAC -3'

Sequencing Primer
(F):5'- GTATCAAGTTGAGCTCCTAATCCTG -3'
(R):5'- AACATGTGGATGCCTCTGAC -3'
Posted On2014-12-04