Incidental Mutation 'R2571:Ccser1'
ID 252508
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 040429-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R2571 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61399944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 21 (C21Y)
Ref Sequence ENSEMBL: ENSMUSP00000067639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000067307] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect probably damaging
Transcript: ENSMUST00000045522
AA Change: C533Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: C533Y

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000067307
AA Change: C21Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067639
Gene: ENSMUSG00000039578
AA Change: C21Y

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
coiled coil region 162 191 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126214
AA Change: C533Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: C533Y

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204337
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,289,044 (GRCm39) N2438S probably benign Het
Ago3 G A 4: 126,257,604 (GRCm39) R476W probably damaging Het
Akap8 T C 17: 32,534,429 (GRCm39) E339G probably damaging Het
Apba2 T C 7: 64,395,498 (GRCm39) V658A probably damaging Het
Bcl3 T C 7: 19,543,452 (GRCm39) D338G probably damaging Het
Bpnt2 C T 4: 4,778,192 (GRCm39) probably null Het
Ccdc138 T C 10: 58,349,044 (GRCm39) Y197H probably benign Het
Ccdc162 T A 10: 41,428,393 (GRCm39) Q499L probably damaging Het
Chil6 A T 3: 106,297,709 (GRCm39) Y229* probably null Het
Cntnap5a C T 1: 116,112,092 (GRCm39) R461C probably damaging Het
Col19a1 T A 1: 24,413,712 (GRCm39) R407S unknown Het
Crlf3 A T 11: 79,938,339 (GRCm39) F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,604,632 (GRCm39) probably null Het
Dnah10 A T 5: 124,852,542 (GRCm39) R1867W probably damaging Het
Dsg3 T C 18: 20,673,062 (GRCm39) V911A probably benign Het
Dzip3 T C 16: 48,792,581 (GRCm39) probably null Het
Evpl T C 11: 116,128,795 (GRCm39) Q10R unknown Het
Glra3 C T 8: 56,563,516 (GRCm39) A337V probably benign Het
H2-T5 C T 17: 36,478,553 (GRCm39) G132R possibly damaging Het
Hcfc2 T C 10: 82,544,857 (GRCm39) F163S probably damaging Het
Hells T C 19: 38,948,177 (GRCm39) V701A possibly damaging Het
Helz A G 11: 107,504,778 (GRCm39) T422A probably benign Het
Hhat G A 1: 192,235,330 (GRCm39) T442I probably damaging Het
Hmces A T 6: 87,913,202 (GRCm39) Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,350,377 (GRCm39) T97S probably damaging Het
Kcne2 C T 16: 92,093,800 (GRCm39) T109I probably damaging Het
Kcnq1 T G 7: 142,661,433 (GRCm39) L113R probably benign Het
Kdm5d T C Y: 940,932 (GRCm39) S1106P probably benign Het
Kel C A 6: 41,665,001 (GRCm39) A588S possibly damaging Het
Kmt2e T A 5: 23,706,885 (GRCm39) F1483I probably benign Het
Krt4 T A 15: 101,829,692 (GRCm39) N279Y probably damaging Het
Lama4 T A 10: 38,918,671 (GRCm39) M384K possibly damaging Het
Lepr C T 4: 101,625,369 (GRCm39) T508I possibly damaging Het
Lypd10 A G 7: 24,412,819 (GRCm39) I76V probably benign Het
Map1lc3b T A 8: 122,320,213 (GRCm39) probably null Het
Me1 T C 9: 86,536,751 (GRCm39) H108R probably damaging Het
Mindy4 T C 6: 55,261,770 (GRCm39) S560P probably damaging Het
Mmp3 T A 9: 7,451,844 (GRCm39) I394N possibly damaging Het
Mmrn2 T C 14: 34,124,896 (GRCm39) S826P probably damaging Het
Or13n4 T A 7: 106,422,933 (GRCm39) M267L probably benign Het
Osbpl7 T C 11: 96,945,667 (GRCm39) L138P probably damaging Het
Pcdhga11 G A 18: 37,889,921 (GRCm39) E310K probably damaging Het
Pcif1 A G 2: 164,726,131 (GRCm39) D39G probably damaging Het
Ppp1r21 C T 17: 88,852,810 (GRCm39) T63I probably benign Het
Prickle2 T C 6: 92,682,381 (GRCm39) Q25R probably benign Het
Ptk2 A G 15: 73,103,768 (GRCm39) L94P probably damaging Het
Ptprg T C 14: 12,122,135 (GRCm38) F333S probably benign Het
Rag2 T A 2: 101,460,312 (GRCm39) H207Q probably damaging Het
Rps6ka1 G T 4: 133,587,923 (GRCm39) probably null Het
Rps6ka4 G T 19: 6,815,471 (GRCm39) H174Q probably damaging Het
Rreb1 C A 13: 38,083,613 (GRCm39) T92K probably damaging Het
Ryr1 A T 7: 28,708,987 (GRCm39) M4793K unknown Het
Ryr1 T A 7: 28,735,551 (GRCm39) M4076L possibly damaging Het
Sec16a A C 2: 26,329,343 (GRCm39) S891A probably benign Het
Sgsh A G 11: 119,241,340 (GRCm39) Y132H probably damaging Het
Sos2 T A 12: 69,682,492 (GRCm39) E242V possibly damaging Het
Spata31d1c G T 13: 65,184,198 (GRCm39) R580L probably damaging Het
Spata9 C A 13: 76,115,880 (GRCm39) probably benign Het
Tead2 T A 7: 44,875,194 (GRCm39) V202E probably damaging Het
Thada T C 17: 84,762,068 (GRCm39) K168E probably damaging Het
Tmem64 T C 4: 15,266,718 (GRCm39) I256T probably damaging Het
Tra2a G T 6: 49,229,421 (GRCm39) probably benign Het
Trim30a T A 7: 104,078,533 (GRCm39) N181I possibly damaging Het
Ttc13 A C 8: 125,410,538 (GRCm39) Y372D probably damaging Het
Vit T C 17: 78,894,174 (GRCm39) V192A probably benign Het
Vmn2r69 T C 7: 85,064,764 (GRCm39) T41A probably benign Het
Vps13d C A 4: 144,875,706 (GRCm39) K1600N probably benign Het
Xpnpep3 A T 15: 81,335,127 (GRCm39) H420L probably damaging Het
Zfp322a A G 13: 23,540,614 (GRCm39) L376P probably damaging Het
Zfp619 T C 7: 39,186,595 (GRCm39) L875P probably damaging Het
Zic5 T A 14: 122,696,890 (GRCm39) Q575L unknown Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R5970:Ccser1 UTSW 6 61,288,226 (GRCm39) missense possibly damaging 0.94
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6257:Ccser1 UTSW 6 61,350,946 (GRCm39) missense probably damaging 0.96
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7729:Ccser1 UTSW 6 61,288,840 (GRCm39) missense probably benign
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8055:Ccser1 UTSW 6 61,290,757 (GRCm39) missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8724:Ccser1 UTSW 6 61,288,199 (GRCm39) missense probably damaging 0.99
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAAACTGCCCAGGATTGTCC -3'
(R):5'- GGAATGTCTGGGAAGCTCTC -3'

Sequencing Primer
(F):5'- CAGGATTGTCCAGCTAGCTAG -3'
(R):5'- GAATGTCTGGGAAGCTCTCTCCAC -3'
Posted On 2014-12-04