Mutagenetix > Incidental Mutations

Incidental Mutation 'R2571:Prickle2'

252513

Institutional Source

Beutler Lab

Gene Symbol

Prickle2

Ensembl Gene

ENSMUSG00000030020

Gene Name

prickle planar cell polarity protein 2

Synonyms

6230400G14Rik, mpk2, 6720451F06Rik

MMRRC Submission

040429-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.514) question?

Stock #

R2571 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92370908-92706155 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92705400 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 25 (Q25R)

Ref Sequence

ENSEMBL: ENSMUSP00000032093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032093]

Predicted Effect

probably benign
Transcript: ENSMUST00000032093
AA Change: Q25R

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000032093
Gene: ENSMUSG00000030020
AA Change: Q25R

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
Pfam:PET	76	176	1.2e-45	PFAM
LIM	185	242	3.05e-10	SMART
LIM	250	302	5.43e-16	SMART
LIM	310	365	2.92e-7	SMART
low complexity region	465	477	N/A	INTRINSIC
low complexity region	534	546	N/A	INTRINSIC
low complexity region	725	753	N/A	INTRINSIC
low complexity region	832	841	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive or PTZ-induced seizures. Mice heterozygous for a knock-out allele exhibit increased susceptibility to electroconvulsive seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	C	1: 71,249,885	N2438S	probably benign	Het
Ago3	G	A	4: 126,363,811	R476W	probably damaging	Het
Akap8	T	C	17: 32,315,455	E339G	probably damaging	Het
Apba2	T	C	7: 64,745,750	V658A	probably damaging	Het
BC049730	A	G	7: 24,713,394	I76V	probably benign	Het
Bcl3	T	C	7: 19,809,527	D338G	probably damaging	Het
Ccdc138	T	C	10: 58,513,222	Y197H	probably benign	Het
Ccdc162	T	A	10: 41,552,397	Q499L	probably damaging	Het
Ccser1	G	A	6: 61,422,960	C21Y	probably damaging	Het
Chil6	A	T	3: 106,390,393	Y229*	probably null	Het
Cntnap5a	C	T	1: 116,184,362	R461C	probably damaging	Het
Col19a1	T	A	1: 24,374,631	R407S	unknown	Het
Crlf3	A	T	11: 80,047,513	F433I	probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Dnah10	A	T	5: 124,775,478	R1867W	probably damaging	Het
Dsg3	T	C	18: 20,540,005	V911A	probably benign	Het
Dzip3	T	C	16: 48,972,218		probably null	Het
Evpl	T	C	11: 116,237,969	Q10R	unknown	Het
Glra3	C	T	8: 56,110,481	A337V	probably benign	Het
Gm8909	C	T	17: 36,167,661	G132R	possibly damaging	Het
Hcfc2	T	C	10: 82,709,023	F163S	probably damaging	Het
Hells	T	C	19: 38,959,733	V701A	possibly damaging	Het
Helz	A	G	11: 107,613,952	T422A	probably benign	Het
Hhat	G	A	1: 192,553,022	T442I	probably damaging	Het
Hmces	A	T	6: 87,936,220	Q319L	possibly damaging	Het
Ighv1-62-1	T	A	12: 115,386,757	T97S	probably damaging	Het
Impad1	C	T	4: 4,778,192		probably null	Het
Kcne2	C	T	16: 92,296,912	T109I	probably damaging	Het
Kcnq1	T	G	7: 143,107,696	L113R	probably benign	Het
Kdm5d	T	C	Y: 940,932	S1106P	probably benign	Het
Kel	C	A	6: 41,688,067	A588S	possibly damaging	Het
Kmt2e	T	A	5: 23,501,887	F1483I	probably benign	Het
Krt4	T	A	15: 101,921,257	N279Y	probably damaging	Het
Lama4	T	A	10: 39,042,675	M384K	possibly damaging	Het
Lepr	C	T	4: 101,768,172	T508I	possibly damaging	Het
Map1lc3b	T	A	8: 121,593,474		probably null	Het
Me1	T	C	9: 86,654,698	H108R	probably damaging	Het
Mindy4	T	C	6: 55,284,785	S560P	probably damaging	Het
Mmp3	T	A	9: 7,451,844	I394N	possibly damaging	Het
Mmrn2	T	C	14: 34,402,939	S826P	probably damaging	Het
Olfr702	T	A	7: 106,823,726	M267L	probably benign	Het
Osbpl7	T	C	11: 97,054,841	L138P	probably damaging	Het
Pcdhga11	G	A	18: 37,756,868	E310K	probably damaging	Het
Pcif1	A	G	2: 164,884,211	D39G	probably damaging	Het
Ppp1r21	C	T	17: 88,545,382	T63I	probably benign	Het
Ptk2	A	G	15: 73,231,919	L94P	probably damaging	Het
Ptprg	T	C	14: 12,122,135	F333S	probably benign	Het
Rag2	T	A	2: 101,629,967	H207Q	probably damaging	Het
Rps6ka1	G	T	4: 133,860,612		probably null	Het
Rps6ka4	G	T	19: 6,838,103	H174Q	probably damaging	Het
Rreb1	C	A	13: 37,899,637	T92K	probably damaging	Het
Ryr1	A	T	7: 29,009,562	M4793K	unknown	Het
Ryr1	T	A	7: 29,036,126	M4076L	possibly damaging	Het
Sec16a	A	C	2: 26,439,331	S891A	probably benign	Het
Sgsh	A	G	11: 119,350,514	Y132H	probably damaging	Het
Sos2	T	A	12: 69,635,718	E242V	possibly damaging	Het
Spata31d1c	G	T	13: 65,036,384	R580L	probably damaging	Het
Spata9	C	A	13: 75,967,761		probably benign	Het
Tead2	T	A	7: 45,225,770	V202E	probably damaging	Het
Thada	T	C	17: 84,454,640	K168E	probably damaging	Het
Tmem64	T	C	4: 15,266,718	I256T	probably damaging	Het
Tra2a	G	T	6: 49,252,487		probably benign	Het
Trim30a	T	A	7: 104,429,326	N181I	possibly damaging	Het
Ttc13	A	C	8: 124,683,799	Y372D	probably damaging	Het
Vit	T	C	17: 78,586,745	V192A	probably benign	Het
Vmn2r69	T	C	7: 85,415,556	T41A	probably benign	Het
Vps13d	C	A	4: 145,149,136	K1600N	probably benign	Het
Xpnpep3	A	T	15: 81,450,926	H420L	probably damaging	Het
Zfp322a	A	G	13: 23,356,444	L376P	probably damaging	Het
Zfp619	T	C	7: 39,537,171	L875P	probably damaging	Het
Zic5	T	A	14: 122,459,478	Q575L	unknown	Het

Other mutations in Prickle2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02962:Prickle2	APN	6	92376422	missense	probably benign	0.00
R0028:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R0122:Prickle2	UTSW	6	92411345	nonsense	probably null
R0555:Prickle2	UTSW	6	92458565	missense	probably benign	0.02
R0940:Prickle2	UTSW	6	92411003	missense	probably benign	0.02
R1394:Prickle2	UTSW	6	92376382	missense	possibly damaging	0.87
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1470:Prickle2	UTSW	6	92458602	missense	probably damaging	0.96
R1599:Prickle2	UTSW	6	92410874	missense	probably benign
R1745:Prickle2	UTSW	6	92376593	missense	probably damaging	1.00
R1801:Prickle2	UTSW	6	92416904	missense	probably damaging	0.98
R1985:Prickle2	UTSW	6	92411452	missense	probably damaging	1.00
R2085:Prickle2	UTSW	6	92376364	missense	probably damaging	0.96
R2147:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R2148:Prickle2	UTSW	6	92425671	missense	probably damaging	0.99
R3547:Prickle2	UTSW	6	92411137	missense	probably damaging	1.00
R4356:Prickle2	UTSW	6	92411509	missense	probably damaging	1.00
R4569:Prickle2	UTSW	6	92422342	missense	probably benign	0.12
R4896:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5004:Prickle2	UTSW	6	92416755	missense	probably benign	0.26
R5045:Prickle2	UTSW	6	92376394	missense	probably damaging	0.96
R5219:Prickle2	UTSW	6	92376530	missense	probably benign
R5247:Prickle2	UTSW	6	92375969	missense	probably damaging	1.00
R5280:Prickle2	UTSW	6	92376210	missense	probably damaging	1.00
R5334:Prickle2	UTSW	6	92425684	missense	probably damaging	1.00
R5780:Prickle2	UTSW	6	92458612	missense	probably benign	0.06
R5960:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R6084:Prickle2	UTSW	6	92416848	nonsense	probably null
R6362:Prickle2	UTSW	6	92458615	missense	possibly damaging	0.77
R6368:Prickle2	UTSW	6	92420237	missense	probably damaging	1.00
R6852:Prickle2	UTSW	6	92376544	missense	probably benign
R7041:Prickle2	UTSW	6	92376305	missense	probably benign	0.08
R7203:Prickle2	UTSW	6	92410978	missense	possibly damaging	0.61
R7352:Prickle2	UTSW	6	92410890	missense	probably benign	0.00
R7405:Prickle2	UTSW	6	92458543	missense	probably damaging	0.96
R7510:Prickle2	UTSW	6	92376470	missense	possibly damaging	0.58
R7562:Prickle2	UTSW	6	92375948	makesense	probably null
R7578:Prickle2	UTSW	6	92411290	missense	probably benign	0.32
R7614:Prickle2	UTSW	6	92425650	missense	possibly damaging	0.46
R7732:Prickle2	UTSW	6	92411224	missense	probably damaging	1.00
X0020:Prickle2	UTSW	6	92416853	missense	probably damaging	0.98
X0026:Prickle2	UTSW	6	92411426	nonsense	probably null
X0066:Prickle2	UTSW	6	92376433	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TAGCAGATGTAGCTGGGCTC -3'
(R):5'- ACCTGGAATCACATGCCCTTC -3'

Sequencing Primer
(F):5'- TGTAGCTGGGCTCTTAAAGGAAC -3'
(R):5'- GGAGAATCTGGTCCCAAGTC -3'

Posted On

2014-12-04