Incidental Mutation 'R0310:Atad2'
ID25253
Institutional Source Beutler Lab
Gene Symbol Atad2
Ensembl Gene ENSMUSG00000022360
Gene NameATPase family, AAA domain containing 2
Synonyms2610509G12Rik
MMRRC Submission 038520-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.368) question?
Stock #R0310 (G1)
Quality Score191
Status Validated
Chromosome15
Chromosomal Location58094044-58135082 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58114257 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 499 (A499V)
Ref Sequence ENSEMBL: ENSMUSP00000043691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038194] [ENSMUST00000228783]
Predicted Effect probably damaging
Transcript: ENSMUST00000038194
AA Change: A499V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043691
Gene: ENSMUSG00000022360
AA Change: A499V

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
low complexity region 237 268 N/A INTRINSIC
low complexity region 337 349 N/A INTRINSIC
AAA 438 579 9.93e-21 SMART
low complexity region 622 633 N/A INTRINSIC
SCOP:d1e32a2 751 912 5e-4 SMART
low complexity region 924 947 N/A INTRINSIC
BROMO 955 1067 1.2e-19 SMART
low complexity region 1213 1235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227134
Predicted Effect probably damaging
Transcript: ENSMUST00000228783
AA Change: A175V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4819 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 93.3%
  • 20x: 82.5%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large family of ATPases has been described, whose key feature is that they share a conserved region of about 220 amino acids that contains an ATP-binding site. The proteins that belong to this family either contain one or two AAA (ATPases Associated with diverse cellular Activities) domains. AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. The protein encoded by this gene contains two AAA domains, as well as a bromodomain. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A C 9: 53,425,671 T92P probably damaging Het
9530053A07Rik G T 7: 28,142,274 V545L probably benign Het
Abca13 T C 11: 9,293,810 V1891A probably benign Het
Abcc1 T A 16: 14,410,927 I346N probably damaging Het
Afdn G T 17: 13,885,508 probably null Het
Ahrr G A 13: 74,283,024 probably benign Het
Akap13 A G 7: 75,614,930 D507G probably damaging Het
Akap8 A T 17: 32,316,260 M260K possibly damaging Het
Akr1b8 T C 6: 34,365,259 V265A probably benign Het
Alpk3 C G 7: 81,078,610 P496R possibly damaging Het
Ankrd13b A G 11: 77,472,745 V249A possibly damaging Het
Arid4a T C 12: 71,075,830 V995A probably benign Het
Ascc3 G T 10: 50,748,926 V1637L probably benign Het
Barhl2 G T 5: 106,457,387 A152E possibly damaging Het
Bbs12 T A 3: 37,321,045 D547E probably damaging Het
Btaf1 A G 19: 37,004,534 M1655V probably damaging Het
Ccdc50 T A 16: 27,406,658 H40Q probably damaging Het
Ccr9 A T 9: 123,774,552 probably benign Het
Cdh15 A G 8: 122,865,436 D654G probably damaging Het
Cebpz T C 17: 78,926,124 D758G probably damaging Het
Cgn C T 3: 94,765,653 R906K possibly damaging Het
Chil3 T A 3: 106,160,523 M109L possibly damaging Het
Cntnap4 A T 8: 112,842,516 probably null Het
Cyp4f18 C T 8: 72,001,012 probably benign Het
Daam2 A G 17: 49,463,924 probably null Het
Ddost T A 4: 138,310,611 H220Q probably benign Het
Dennd2a C T 6: 39,464,201 probably benign Het
Depdc1b G A 13: 108,373,841 V296I possibly damaging Het
Dnah5 A T 15: 28,299,110 R1539S probably benign Het
Dusp22 T C 13: 30,705,658 I74T probably damaging Het
Dyx1c1 A T 9: 72,972,336 D386V probably damaging Het
E130309D02Rik G T 5: 143,307,888 T278K probably benign Het
Epc1 A G 18: 6,440,202 probably benign Het
Epha7 A G 4: 28,961,301 I845V probably benign Het
Fanci C T 7: 79,407,417 probably benign Het
Fbn1 T A 2: 125,363,644 E1104V probably damaging Het
Fbxo8 T A 8: 56,590,097 F205L probably damaging Het
Fetub T C 16: 22,929,756 probably benign Het
Frs3 T C 17: 47,703,822 V480A probably benign Het
Gne C A 4: 44,060,157 E79* probably null Het
Hrc T A 7: 45,336,497 H357Q probably benign Het
Idh1 T C 1: 65,161,920 M291V probably damaging Het
Iltifb T A 10: 118,293,185 H133L probably benign Het
Ino80b T C 6: 83,124,091 E165G probably damaging Het
Inppl1 A T 7: 101,828,499 probably benign Het
Ip6k2 T C 9: 108,799,233 probably benign Het
Itga11 A T 9: 62,760,346 I654F probably damaging Het
Jag2 G T 12: 112,913,377 probably benign Het
Katna1 G T 10: 7,743,749 probably benign Het
Kcnh4 G T 11: 100,746,169 S707Y probably benign Het
Kcnn2 T G 18: 45,560,518 L387R probably damaging Het
Khnyn A G 14: 55,887,968 T503A probably damaging Het
Lama5 G T 2: 180,181,566 probably benign Het
Lmbr1l A T 15: 98,908,773 probably benign Het
Mast4 A T 13: 102,754,161 S870T possibly damaging Het
Med1 A G 11: 98,167,574 Y266H probably benign Het
Med13 A T 11: 86,346,003 N109K probably benign Het
Mgam T C 6: 40,761,035 probably benign Het
Mmp8 A G 9: 7,561,454 Q153R probably benign Het
Mpeg1 C A 19: 12,461,691 T171N probably benign Het
Mtus2 T C 5: 148,107,019 S806P probably benign Het
Naip2 T A 13: 100,148,842 E1226V probably damaging Het
Naip6 A G 13: 100,308,213 F246L possibly damaging Het
Nav3 T C 10: 109,767,128 I1187V possibly damaging Het
Nbeal1 T C 1: 60,305,370 probably benign Het
Nbeal2 C A 9: 110,638,163 V653L probably damaging Het
Ndufa9 G T 6: 126,827,532 probably benign Het
Nlrp5 G T 7: 23,430,157 C883F probably damaging Het
Nr0b2 C A 4: 133,555,992 probably null Het
Olfr24 T A 9: 18,755,333 M101L possibly damaging Het
Olfr799 T A 10: 129,647,731 V201E probably damaging Het
Olfr822 G A 10: 130,074,823 V138I probably benign Het
Olfr888 T A 9: 38,109,486 S267T possibly damaging Het
Pkhd1 A T 1: 20,549,822 probably null Het
Pkhd1l1 A G 15: 44,522,738 probably benign Het
Ppm1l A G 3: 69,549,461 K237R probably benign Het
Ppp1r18 T C 17: 35,873,711 probably benign Het
Ptpn3 A T 4: 57,204,958 D734E probably benign Het
Pxdn T C 12: 30,015,529 C1283R probably damaging Het
Rbm12 A G 2: 156,095,724 probably benign Het
Rttn A T 18: 89,009,460 probably benign Het
Sgsm1 G T 5: 113,263,705 H431Q probably benign Het
Siah3 A G 14: 75,525,927 N206S possibly damaging Het
Slc22a15 G T 3: 101,860,511 D521E probably benign Het
Sprr2k A T 3: 92,433,463 probably benign Het
Stab2 G A 10: 86,967,613 probably benign Het
Sval3 T A 6: 41,968,186 L16Q probably damaging Het
Sycp2 C G 2: 178,381,855 S456T probably benign Het
Tk1 T C 11: 117,817,095 probably benign Het
Tlk2 C A 11: 105,254,973 A335E probably benign Het
Tmtc1 T C 6: 148,249,581 K659E probably benign Het
Tnk2 C T 16: 32,680,590 P907L probably benign Het
Trim14 C A 4: 46,522,043 K211N probably damaging Het
Trim15 A C 17: 36,866,986 L39R probably damaging Het
Tspan15 T A 10: 62,188,093 T269S probably benign Het
Ttc7 T A 17: 87,361,864 D646E probably benign Het
Ttll6 A T 11: 96,147,556 Q410L probably benign Het
Unc79 A G 12: 103,061,407 Q419R probably damaging Het
Vcam1 A T 3: 116,114,416 Y666N possibly damaging Het
Vmn1r10 A T 6: 57,113,501 Y26F probably damaging Het
Vmn1r80 A G 7: 12,193,848 N295S probably benign Het
Vmn2r114 A T 17: 23,290,943 H854Q probably benign Het
Vmn2r2 A T 3: 64,134,618 D225E probably damaging Het
Vmn2r4 A T 3: 64,389,434 Y643* probably null Het
Vmn2r52 T A 7: 10,159,466 Y582F probably damaging Het
Vmn2r60 G T 7: 42,195,140 L642F possibly damaging Het
Zbtb20 T C 16: 43,609,746 S207P probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zkscan7 G T 9: 122,888,893 E118* probably null Het
Other mutations in Atad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Atad2 APN 15 58116820 missense probably damaging 1.00
IGL00556:Atad2 APN 15 58100080 missense probably damaging 1.00
IGL00674:Atad2 APN 15 58108386 missense possibly damaging 0.49
IGL01407:Atad2 APN 15 58104525 missense probably benign
IGL02557:Atad2 APN 15 58122597 missense probably benign 0.04
IGL03060:Atad2 APN 15 58122446 unclassified probably benign
IGL03308:Atad2 APN 15 58102523 missense probably benign 0.00
R0113:Atad2 UTSW 15 58120934 unclassified probably benign
R0195:Atad2 UTSW 15 58099954 splice site probably benign
R0499:Atad2 UTSW 15 58103240 missense possibly damaging 0.92
R0499:Atad2 UTSW 15 58120949 missense probably benign
R0564:Atad2 UTSW 15 58125833 splice site probably benign
R0578:Atad2 UTSW 15 58105568 missense probably damaging 1.00
R0581:Atad2 UTSW 15 58126664 missense probably benign
R0667:Atad2 UTSW 15 58098719 missense probably benign 0.01
R0697:Atad2 UTSW 15 58105543 missense possibly damaging 0.91
R1219:Atad2 UTSW 15 58134911 missense probably benign 0.00
R1271:Atad2 UTSW 15 58126589 missense probably benign 0.00
R1544:Atad2 UTSW 15 58103364 missense probably damaging 1.00
R1624:Atad2 UTSW 15 58100019 missense probably damaging 1.00
R1853:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1854:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1855:Atad2 UTSW 15 58097289 missense possibly damaging 0.56
R1860:Atad2 UTSW 15 58096718 splice site probably null
R1861:Atad2 UTSW 15 58096718 splice site probably null
R1876:Atad2 UTSW 15 58106868 missense probably benign 0.00
R1938:Atad2 UTSW 15 58096705 missense possibly damaging 0.76
R2158:Atad2 UTSW 15 58098566 missense possibly damaging 0.95
R3756:Atad2 UTSW 15 58099723 missense probably benign 0.01
R4256:Atad2 UTSW 15 58116856 missense probably damaging 1.00
R4762:Atad2 UTSW 15 58108362 missense probably benign
R4827:Atad2 UTSW 15 58108348 missense probably benign 0.07
R4838:Atad2 UTSW 15 58103283 missense probably damaging 1.00
R5238:Atad2 UTSW 15 58108337 missense possibly damaging 0.90
R5247:Atad2 UTSW 15 58104478 nonsense probably null
R5685:Atad2 UTSW 15 58116798 missense possibly damaging 0.95
R5790:Atad2 UTSW 15 58126594 missense probably damaging 1.00
R5813:Atad2 UTSW 15 58099854 missense probably benign 0.42
R5886:Atad2 UTSW 15 58098514 nonsense probably null
R5955:Atad2 UTSW 15 58105659 missense probably benign 0.06
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6034:Atad2 UTSW 15 58108563 missense probably damaging 1.00
R6111:Atad2 UTSW 15 58108091 missense probably benign 0.07
R6209:Atad2 UTSW 15 58118415 missense probably damaging 1.00
R6587:Atad2 UTSW 15 58121048 missense probably benign 0.03
R6856:Atad2 UTSW 15 58106813 missense probably damaging 1.00
R7106:Atad2 UTSW 15 58116766 critical splice donor site probably null
R7178:Atad2 UTSW 15 58117293 missense probably damaging 1.00
R7290:Atad2 UTSW 15 58098651 missense probably benign 0.00
R7421:Atad2 UTSW 15 58134926 missense probably benign 0.40
R7583:Atad2 UTSW 15 58126664 missense probably benign
R7861:Atad2 UTSW 15 58125780 missense probably benign 0.10
R7886:Atad2 UTSW 15 58126136 missense probably damaging 1.00
R7944:Atad2 UTSW 15 58125780 missense probably benign 0.10
R7969:Atad2 UTSW 15 58126136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- gcctggTGAGCCTAAAACTTGATAAAGA -3'
(R):5'- TGACAAACTGTTAAGCAAGAGTGAATGGA -3'

Sequencing Primer
(F):5'- tcctccctcccctctcc -3'
(R):5'- TGTTAAGCAAGAGTGAATGGAAATAG -3'
Posted On2013-04-16