Incidental Mutation 'R2571:Kcnq1'
ID252539
Institutional Source Beutler Lab
Gene Symbol Kcnq1
Ensembl Gene ENSMUSG00000009545
Gene Namepotassium voltage-gated channel, subfamily Q, member 1
SynonymsKVLQT1, Kcna9
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2571 (G1)
Quality Score183
Status Not validated
Chromosome7
Chromosomal Location143106362-143427042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 143107696 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 113 (L113R)
Ref Sequence ENSEMBL: ENSMUSP00000009689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009689] [ENSMUST00000185383] [ENSMUST00000186284] [ENSMUST00000186288] [ENSMUST00000186488] [ENSMUST00000186798] [ENSMUST00000187213]
Predicted Effect probably benign
Transcript: ENSMUST00000009689
AA Change: L113R

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000009689
Gene: ENSMUSG00000009545
AA Change: L113R

DomainStartEndE-ValueType
Pfam:Ion_trans 121 358 7.5e-28 PFAM
Pfam:Ion_trans_2 261 351 5.9e-13 PFAM
low complexity region 404 427 N/A INTRINSIC
Pfam:KCNQ_channel 480 624 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185383
AA Change: L49R

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139548
Gene: ENSMUSG00000009545
AA Change: L49R

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Ion_trans 93 282 1.4e-23 PFAM
Pfam:Ion_trans_2 198 287 1.2e-11 PFAM
low complexity region 340 363 N/A INTRINSIC
low complexity region 422 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186284
Predicted Effect probably benign
Transcript: ENSMUST00000186288
Predicted Effect probably benign
Transcript: ENSMUST00000186488
SMART Domains Protein: ENSMUSP00000140673
Gene: ENSMUSG00000009545

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186798
Predicted Effect probably benign
Transcript: ENSMUST00000187213
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated potassium channel required for repolarization phase of the cardiac action potential. This protein can form heteromultimers with two other potassium channel proteins, KCNE1 and KCNE3. Mutations in this gene are associated with hereditary long QT syndrome 1 (also known as Romano-Ward syndrome), Jervell and Lange-Nielsen syndrome, and familial atrial fibrillation. This gene exhibits tissue-specific imprinting, with preferential expression from the maternal allele in some tissues, and biallelic expression in others. This gene is located in a region of chromosome 11 amongst other imprinted genes that are associated with Beckwith-Wiedemann syndrome (BWS), and itself has been shown to be disrupted by chromosomal rearrangements in patients with BWS. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous targeted null or spontaneous mutants show circling and head-tossing behavior and are deaf with inner ear dysmorphology. Paternal inheritance of a deletion of an imprinted control region within an intron of this gene results in small body size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Kcnq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Kcnq1 APN 7 143194278 nonsense probably null
IGL01936:Kcnq1 APN 7 143184504 missense possibly damaging 0.83
IGL02134:Kcnq1 APN 7 143183716 missense possibly damaging 0.66
IGL02613:Kcnq1 APN 7 143426126 unclassified probably benign
R0841:Kcnq1 UTSW 7 143107452 missense probably benign 0.07
R1843:Kcnq1 UTSW 7 143183120 missense probably benign 0.03
R2910:Kcnq1 UTSW 7 143425962 missense probably damaging 1.00
R3943:Kcnq1 UTSW 7 143426088 missense probably damaging 1.00
R4274:Kcnq1 UTSW 7 143184442 missense probably damaging 1.00
R4686:Kcnq1 UTSW 7 143107729 missense probably benign 0.44
R4795:Kcnq1 UTSW 7 143182757 missense probably benign 0.01
R5133:Kcnq1 UTSW 7 143194346 critical splice donor site probably null
R5151:Kcnq1 UTSW 7 143426012 missense probably benign
R5658:Kcnq1 UTSW 7 143363695 critical splice donor site probably null
R5732:Kcnq1 UTSW 7 143148756 intron probably benign
R5990:Kcnq1 UTSW 7 143261368 missense probably damaging 1.00
R6025:Kcnq1 UTSW 7 143106433 unclassified probably benign
R6111:Kcnq1 UTSW 7 143107737 missense probably benign 0.00
R6534:Kcnq1 UTSW 7 143194327 missense probably benign 0.16
R7196:Kcnq1 UTSW 7 143358741 missense possibly damaging 0.91
R7409:Kcnq1 UTSW 7 143109415 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGTGTCCCTTCTCACTGGAGC -3'
(R):5'- CAGCAGAGTCCCTGAGTTTAAGG -3'

Sequencing Primer
(F):5'- TGAGGGCAGCACGGTCTATG -3'
(R):5'- AGTTTAAGGGACCGACTCTCAGTC -3'
Posted On2014-12-04