Incidental Mutation 'R2571:Osbpl7'
ID252565
Institutional Source Beutler Lab
Gene Symbol Osbpl7
Ensembl Gene ENSMUSG00000038534
Gene Nameoxysterol binding protein-like 7
Synonyms
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97050628-97068904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97054841 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 138 (L138P)
Ref Sequence ENSEMBL: ENSMUSP00000126902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090020] [ENSMUST00000168565]
Predicted Effect probably damaging
Transcript: ENSMUST00000090020
AA Change: L309P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000087474
Gene: ENSMUSG00000038534
AA Change: L309P

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
low complexity region 138 154 N/A INTRINSIC
PH 174 270 7.76e-11 SMART
low complexity region 533 551 N/A INTRINSIC
Pfam:Oxysterol_BP 599 947 4.6e-135 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154084
Predicted Effect probably damaging
Transcript: ENSMUST00000168565
AA Change: L138P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126902
Gene: ENSMUSG00000038534
AA Change: L138P

DomainStartEndE-ValueType
PH 3 99 7.76e-11 SMART
Pfam:Oxysterol_BP 427 776 8.8e-140 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Two transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp322a A G 13: 23,356,444 L376P probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Osbpl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Osbpl7 APN 11 97052300 missense probably benign 0.00
IGL02041:Osbpl7 APN 11 97060508 missense probably benign 0.08
IGL02322:Osbpl7 APN 11 97056124 missense probably benign 0.18
IGL02396:Osbpl7 APN 11 97055551 missense probably damaging 1.00
IGL02441:Osbpl7 APN 11 97067702 missense probably damaging 1.00
IGL02668:Osbpl7 APN 11 97067205 missense possibly damaging 0.90
IGL03003:Osbpl7 APN 11 97050695 missense probably benign
R0377:Osbpl7 UTSW 11 97055934 missense probably damaging 0.99
R0549:Osbpl7 UTSW 11 97067542 missense probably damaging 1.00
R0848:Osbpl7 UTSW 11 97060524 missense probably damaging 1.00
R0919:Osbpl7 UTSW 11 97056101 missense possibly damaging 0.92
R1845:Osbpl7 UTSW 11 97059128 missense probably damaging 1.00
R2119:Osbpl7 UTSW 11 97056079 missense probably benign 0.02
R2418:Osbpl7 UTSW 11 97059178 missense probably benign 0.00
R3746:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3747:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R3749:Osbpl7 UTSW 11 97056053 missense probably damaging 1.00
R4590:Osbpl7 UTSW 11 97056272 missense probably damaging 1.00
R4602:Osbpl7 UTSW 11 97056269 missense possibly damaging 0.77
R4857:Osbpl7 UTSW 11 97056669 intron probably benign
R4898:Osbpl7 UTSW 11 97060150 missense probably damaging 0.98
R5160:Osbpl7 UTSW 11 97054556 missense probably damaging 1.00
R5292:Osbpl7 UTSW 11 97067953 missense probably benign 0.07
R5685:Osbpl7 UTSW 11 97060277 missense probably damaging 1.00
R5786:Osbpl7 UTSW 11 97065832 missense probably damaging 1.00
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6030:Osbpl7 UTSW 11 97052261 missense probably benign 0.15
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6038:Osbpl7 UTSW 11 97050716 missense probably benign
R6239:Osbpl7 UTSW 11 97052824 critical splice donor site probably null
R6715:Osbpl7 UTSW 11 97054599 missense probably damaging 1.00
R6920:Osbpl7 UTSW 11 97050758 missense probably damaging 0.99
R7179:Osbpl7 UTSW 11 97050836 missense probably benign 0.05
R7222:Osbpl7 UTSW 11 97060538 missense probably damaging 1.00
R7413:Osbpl7 UTSW 11 97054878 critical splice donor site probably null
R7773:Osbpl7 UTSW 11 97050722 missense probably benign
R7806:Osbpl7 UTSW 11 97056128 missense probably benign 0.01
R7884:Osbpl7 UTSW 11 97060457 missense possibly damaging 0.72
R7967:Osbpl7 UTSW 11 97060457 missense possibly damaging 0.72
X0020:Osbpl7 UTSW 11 97056559 missense probably benign 0.01
X0060:Osbpl7 UTSW 11 97060510 nonsense probably null
X0062:Osbpl7 UTSW 11 97065643 missense probably damaging 0.98
Z1176:Osbpl7 UTSW 11 97060153 missense not run
Predicted Primers PCR Primer
(F):5'- GTGCCACTCATCGGAAGGTAAG -3'
(R):5'- GAGGACTTGATCATCTTGGAGC -3'

Sequencing Primer
(F):5'- TAAGACGGGCCCTGGAGTG -3'
(R):5'- ACTTGATCATCTTGGAGCAGAGG -3'
Posted On2014-12-04