Incidental Mutation 'R2571:Zfp322a'
List |< first << previous [record 70 of 72] next >> last >|
ID252575
Institutional Source Beutler Lab
Gene Symbol Zfp322a
Ensembl Gene ENSMUSG00000046351
Gene Namezinc finger protein 322A
Synonyms
MMRRC Submission 040429-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R2571 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23353103-23369208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23356444 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 376 (L376P)
Ref Sequence ENSEMBL: ENSMUSP00000061524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050101] [ENSMUST00000125328] [ENSMUST00000145451] [ENSMUST00000152557]
Predicted Effect probably damaging
Transcript: ENSMUST00000050101
AA Change: L376P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061524
Gene: ENSMUSG00000046351
AA Change: L376P

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
ZnF_C2H2 165 187 2.95e-3 SMART
ZnF_C2H2 193 215 1.95e-3 SMART
ZnF_C2H2 221 243 4.79e-3 SMART
ZnF_C2H2 249 271 5.14e-3 SMART
ZnF_C2H2 277 299 8.94e-3 SMART
ZnF_C2H2 303 325 5.68e1 SMART
ZnF_C2H2 361 383 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122940
Predicted Effect probably benign
Transcript: ENSMUST00000125328
SMART Domains Protein: ENSMUSP00000120804
Gene: ENSMUSG00000046351

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145451
SMART Domains Protein: ENSMUSP00000119883
Gene: ENSMUSG00000046351

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152557
SMART Domains Protein: ENSMUSP00000118754
Gene: ENSMUSG00000046351

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224779
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZNF322A is a member of the zinc-finger transcription factor family and may regulate transcriptional activation in MAPK (see MAPK1; MIM 176948) signaling pathways (Li et al., 2004 [PubMed 15555580]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,249,885 N2438S probably benign Het
Ago3 G A 4: 126,363,811 R476W probably damaging Het
Akap8 T C 17: 32,315,455 E339G probably damaging Het
Apba2 T C 7: 64,745,750 V658A probably damaging Het
BC049730 A G 7: 24,713,394 I76V probably benign Het
Bcl3 T C 7: 19,809,527 D338G probably damaging Het
Ccdc138 T C 10: 58,513,222 Y197H probably benign Het
Ccdc162 T A 10: 41,552,397 Q499L probably damaging Het
Ccser1 G A 6: 61,422,960 C21Y probably damaging Het
Chil6 A T 3: 106,390,393 Y229* probably null Het
Cntnap5a C T 1: 116,184,362 R461C probably damaging Het
Col19a1 T A 1: 24,374,631 R407S unknown Het
Crlf3 A T 11: 80,047,513 F433I probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Dnah10 A T 5: 124,775,478 R1867W probably damaging Het
Dsg3 T C 18: 20,540,005 V911A probably benign Het
Dzip3 T C 16: 48,972,218 probably null Het
Evpl T C 11: 116,237,969 Q10R unknown Het
Glra3 C T 8: 56,110,481 A337V probably benign Het
Gm8909 C T 17: 36,167,661 G132R possibly damaging Het
Hcfc2 T C 10: 82,709,023 F163S probably damaging Het
Hells T C 19: 38,959,733 V701A possibly damaging Het
Helz A G 11: 107,613,952 T422A probably benign Het
Hhat G A 1: 192,553,022 T442I probably damaging Het
Hmces A T 6: 87,936,220 Q319L possibly damaging Het
Ighv1-62-1 T A 12: 115,386,757 T97S probably damaging Het
Impad1 C T 4: 4,778,192 probably null Het
Kcne2 C T 16: 92,296,912 T109I probably damaging Het
Kcnq1 T G 7: 143,107,696 L113R probably benign Het
Kdm5d T C Y: 940,932 S1106P probably benign Het
Kel C A 6: 41,688,067 A588S possibly damaging Het
Kmt2e T A 5: 23,501,887 F1483I probably benign Het
Krt4 T A 15: 101,921,257 N279Y probably damaging Het
Lama4 T A 10: 39,042,675 M384K possibly damaging Het
Lepr C T 4: 101,768,172 T508I possibly damaging Het
Map1lc3b T A 8: 121,593,474 probably null Het
Me1 T C 9: 86,654,698 H108R probably damaging Het
Mindy4 T C 6: 55,284,785 S560P probably damaging Het
Mmp3 T A 9: 7,451,844 I394N possibly damaging Het
Mmrn2 T C 14: 34,402,939 S826P probably damaging Het
Olfr702 T A 7: 106,823,726 M267L probably benign Het
Osbpl7 T C 11: 97,054,841 L138P probably damaging Het
Pcdhga11 G A 18: 37,756,868 E310K probably damaging Het
Pcif1 A G 2: 164,884,211 D39G probably damaging Het
Ppp1r21 C T 17: 88,545,382 T63I probably benign Het
Prickle2 T C 6: 92,705,400 Q25R probably benign Het
Ptk2 A G 15: 73,231,919 L94P probably damaging Het
Ptprg T C 14: 12,122,135 F333S probably benign Het
Rag2 T A 2: 101,629,967 H207Q probably damaging Het
Rps6ka1 G T 4: 133,860,612 probably null Het
Rps6ka4 G T 19: 6,838,103 H174Q probably damaging Het
Rreb1 C A 13: 37,899,637 T92K probably damaging Het
Ryr1 A T 7: 29,009,562 M4793K unknown Het
Ryr1 T A 7: 29,036,126 M4076L possibly damaging Het
Sec16a A C 2: 26,439,331 S891A probably benign Het
Sgsh A G 11: 119,350,514 Y132H probably damaging Het
Sos2 T A 12: 69,635,718 E242V possibly damaging Het
Spata31d1c G T 13: 65,036,384 R580L probably damaging Het
Spata9 C A 13: 75,967,761 probably benign Het
Tead2 T A 7: 45,225,770 V202E probably damaging Het
Thada T C 17: 84,454,640 K168E probably damaging Het
Tmem64 T C 4: 15,266,718 I256T probably damaging Het
Tra2a G T 6: 49,252,487 probably benign Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Ttc13 A C 8: 124,683,799 Y372D probably damaging Het
Vit T C 17: 78,586,745 V192A probably benign Het
Vmn2r69 T C 7: 85,415,556 T41A probably benign Het
Vps13d C A 4: 145,149,136 K1600N probably benign Het
Xpnpep3 A T 15: 81,450,926 H420L probably damaging Het
Zfp619 T C 7: 39,537,171 L875P probably damaging Het
Zic5 T A 14: 122,459,478 Q575L unknown Het
Other mutations in Zfp322a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Zfp322a APN 13 23357443 missense probably damaging 0.97
R1395:Zfp322a UTSW 13 23356775 missense probably benign 0.01
R1975:Zfp322a UTSW 13 23356904 missense probably damaging 1.00
R2100:Zfp322a UTSW 13 23357290 missense possibly damaging 0.85
R2332:Zfp322a UTSW 13 23357324 missense probably damaging 1.00
R4959:Zfp322a UTSW 13 23356882 missense probably damaging 1.00
R5245:Zfp322a UTSW 13 23356986 nonsense probably null
R5310:Zfp322a UTSW 13 23357362 missense possibly damaging 0.90
R5389:Zfp322a UTSW 13 23356979 missense probably damaging 1.00
R5525:Zfp322a UTSW 13 23357515 missense probably benign
R5810:Zfp322a UTSW 13 23357409 nonsense probably null
R7299:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7299:Zfp322a UTSW 13 23357144 missense probably benign 0.22
R7301:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7301:Zfp322a UTSW 13 23357144 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- GACTCTCTGAACTCCAATGAAGTCTG -3'
(R):5'- GCTCAGACTTTATTGTACATCAGAG -3'

Sequencing Primer
(F):5'- CTGAACTCCAATGAAGTCTGAGATC -3'
(R):5'- GAGAATTCATATGGAAGAAAAACCAC -3'
Posted On2014-12-04