Incidental Mutation 'R2858:Ifit1bl1'
ID252605
Institutional Source Beutler Lab
Gene Symbol Ifit1bl1
Ensembl Gene ENSMUSG00000079339
Gene Nameinterferon induced protein with tetratricpeptide repeats 1B like 1
SynonymsGm14446
MMRRC Submission 040448-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2858 (G1)
Quality Score195
Status Validated
Chromosome19
Chromosomal Location34592888-34601968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34594322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 245 (I245K)
Ref Sequence ENSEMBL: ENSMUSP00000132781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112467] [ENSMUST00000168254]
Predicted Effect probably benign
Transcript: ENSMUST00000112467
AA Change: I245K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000108086
Gene: ENSMUSG00000079339
AA Change: I245K

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168254
AA Change: I245K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132781
Gene: ENSMUSG00000079339
AA Change: I245K

DomainStartEndE-ValueType
TPR 60 93 3.41e1 SMART
TPR 100 133 6.24e1 SMART
TPR 146 179 3.69e1 SMART
low complexity region 217 231 N/A INTRINSIC
TPR 249 282 6.75e1 SMART
TPR 338 371 1.64e1 SMART
low complexity region 417 429 N/A INTRINSIC
TPR 433 466 1.08e1 SMART
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik T A 5: 107,545,801 F95I probably benign Het
5430403G16Rik T C 5: 109,675,953 T544A probably benign Het
Abcg5 A G 17: 84,670,220 probably null Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Chd4 A G 6: 125,104,886 K481R probably damaging Het
Cyp2a22 T C 7: 26,934,262 Y341C probably damaging Het
Ddb2 T C 2: 91,216,677 T338A probably damaging Het
Fat2 A G 11: 55,283,773 V2038A possibly damaging Het
Fbxo36 A G 1: 84,896,595 K104R probably benign Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Helz G A 11: 107,672,927 probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Ighv1-22 T C 12: 114,746,298 D109G probably damaging Het
Kcnk10 T C 12: 98,435,289 R376G possibly damaging Het
Lrrc66 T A 5: 73,607,303 E799V probably benign Het
Lrrc7 T A 3: 158,161,725 N793I probably damaging Het
Nexn C T 3: 152,248,043 E247K probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr743 T A 14: 50,533,440 N9K probably benign Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Polq T A 16: 37,062,753 F1760I possibly damaging Het
Ppp1r1b T C 11: 98,355,319 probably benign Het
Psmf1 A G 2: 151,729,536 L169P probably damaging Het
Rcbtb1 T A 14: 59,221,412 probably null Het
S1pr4 C A 10: 81,499,239 A134S probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc24a1 T C 9: 64,949,332 I98V unknown Het
Slc6a21 G A 7: 45,280,528 A147T possibly damaging Het
Sycp3 A G 10: 88,467,372 E166G probably damaging Het
Uhrf1bp1 G T 17: 27,885,462 R494L probably damaging Het
Vmn2r82 T A 10: 79,381,256 I474N probably damaging Het
Other mutations in Ifit1bl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Ifit1bl1 UTSW 19 34594015 missense possibly damaging 0.79
R0420:Ifit1bl1 UTSW 19 34594514 missense probably damaging 1.00
R1161:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1310:Ifit1bl1 UTSW 19 34593696 missense possibly damaging 0.80
R1483:Ifit1bl1 UTSW 19 34594641 missense possibly damaging 0.88
R1606:Ifit1bl1 UTSW 19 34594044 missense probably benign 0.00
R1753:Ifit1bl1 UTSW 19 34593860 missense probably benign 0.15
R1778:Ifit1bl1 UTSW 19 34594193 missense probably damaging 1.00
R2204:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2205:Ifit1bl1 UTSW 19 34594341 missense probably benign 0.23
R2442:Ifit1bl1 UTSW 19 34594889 missense probably benign 0.00
R3422:Ifit1bl1 UTSW 19 34593950 missense probably benign 0.04
R4081:Ifit1bl1 UTSW 19 34594640 missense possibly damaging 0.63
R4125:Ifit1bl1 UTSW 19 34594788 missense probably damaging 0.99
R4616:Ifit1bl1 UTSW 19 34594610 missense probably damaging 1.00
R4731:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4732:Ifit1bl1 UTSW 19 34594321 missense probably benign 0.02
R4849:Ifit1bl1 UTSW 19 34594676 missense probably damaging 1.00
R5026:Ifit1bl1 UTSW 19 34593893 missense probably damaging 1.00
R5049:Ifit1bl1 UTSW 19 34594081 nonsense probably null
R5414:Ifit1bl1 UTSW 19 34593924 missense probably damaging 0.99
R5561:Ifit1bl1 UTSW 19 34593797 nonsense probably null
R5586:Ifit1bl1 UTSW 19 34594277 missense probably damaging 0.98
R6345:Ifit1bl1 UTSW 19 34594170 nonsense probably null
R6382:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R6515:Ifit1bl1 UTSW 19 34594499 missense probably damaging 1.00
R7073:Ifit1bl1 UTSW 19 34599267 critical splice donor site probably null
R7180:Ifit1bl1 UTSW 19 34593902 missense probably damaging 1.00
R7210:Ifit1bl1 UTSW 19 34594164 missense probably benign 0.00
R7665:Ifit1bl1 UTSW 19 34594883 missense probably benign 0.16
R7724:Ifit1bl1 UTSW 19 34594005 missense probably benign 0.00
R7783:Ifit1bl1 UTSW 19 34593936 missense probably benign 0.01
R7944:Ifit1bl1 UTSW 19 34593824 missense probably benign 0.00
R8251:Ifit1bl1 UTSW 19 34594832 missense possibly damaging 0.85
R8427:Ifit1bl1 UTSW 19 34599266 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAATGGATGGATTGGTCTGCTC -3'
(R):5'- TAGCCTATCGCCTGGATCAC -3'

Sequencing Primer
(F):5'- CCCCTCTTGGTTGCATGTTTGAAG -3'
(R):5'- GGATCACATTGATGGCACTTCGC -3'
Posted On2014-12-04