Incidental Mutation 'R2859:Cadm3'
ID252610
Institutional Source Beutler Lab
Gene Symbol Cadm3
Ensembl Gene ENSMUSG00000005338
Gene Namecell adhesion molecule 3
SynonymsSynCAM3, Tsll1, Igsf4b, BIgR, Necl-1, Necl1
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2859 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173333258-173367695 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 173346545 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 34 (S34P)
Ref Sequence ENSEMBL: ENSMUSP00000106851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000111220] [ENSMUST00000147604]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005470
AA Change: S68P

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338
AA Change: S68P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111220
AA Change: S34P

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338
AA Change: S34P

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136540
Predicted Effect probably benign
Transcript: ENSMUST00000147604
SMART Domains Protein: ENSMUSP00000119465
Gene: ENSMUSG00000037860

DomainStartEndE-ValueType
PYRIN 6 83 2.11e-15 SMART
Pfam:HIN 156 322 2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157032
Meta Mutation Damage Score 0.1045 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-independent cell-cell adhesion protein that can form homodimers or heterodimers with other nectin proteins. The encoded protein has both homophilic and heterophilic cell-cell adhesion activity. This gene is reported to be a tumor suppressor gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed myelination. Other mice with ubiquitous conditional deletion of the gene do not display neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Cadm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01915:Cadm3 APN 1 173341108 missense possibly damaging 0.66
IGL01989:Cadm3 APN 1 173338011 unclassified probably benign
IGL02224:Cadm3 APN 1 173338061 missense possibly damaging 0.51
IGL03105:Cadm3 APN 1 173345016 missense probably damaging 0.96
R0243:Cadm3 UTSW 1 173346573 unclassified probably benign
R0583:Cadm3 UTSW 1 173341171 missense probably benign 0.00
R0689:Cadm3 UTSW 1 173344452 missense possibly damaging 0.95
R2060:Cadm3 UTSW 1 173344402 missense probably damaging 1.00
R3764:Cadm3 UTSW 1 173346497 missense probably damaging 1.00
R4077:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4079:Cadm3 UTSW 1 173341669 missense probably benign 0.01
R4521:Cadm3 UTSW 1 173345063 splice site probably null
R4670:Cadm3 UTSW 1 173346446 missense probably damaging 1.00
R4965:Cadm3 UTSW 1 173337097 missense probably damaging 1.00
R5267:Cadm3 UTSW 1 173337102 missense probably damaging 1.00
R6273:Cadm3 UTSW 1 173349124 unclassified probably benign
R6315:Cadm3 UTSW 1 173344352 missense probably benign 0.16
R6342:Cadm3 UTSW 1 173341108 missense possibly damaging 0.66
R6544:Cadm3 UTSW 1 173367411 critical splice donor site probably null
R6565:Cadm3 UTSW 1 173341709 missense possibly damaging 0.81
R7813:Cadm3 UTSW 1 173344389 missense probably benign 0.00
R8024:Cadm3 UTSW 1 173338055 missense probably damaging 0.99
R8078:Cadm3 UTSW 1 173341059 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACATACCCCGTGTTTCTTAGC -3'
(R):5'- AGTGTTTGTGACCCTGTCCG -3'

Sequencing Primer
(F):5'- GTTTCTTAGCCTCTGAACTACACAG -3'
(R):5'- CTCAACAAGAGGTGAAGCTTTCTGTG -3'
Posted On2014-12-04