Mutagenetix > Incidental Mutation

Incidental Mutation 'R2859:Mastl'

252614

Institutional Source

Beutler Lab

Gene Symbol

Mastl

Ensembl Gene

ENSMUSG00000026779

Gene Name

microtubule associated serine/threonine kinase-like

Synonyms

2700091H24Rik, THC2

MMRRC Submission

040449-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2859 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

23115606-23156024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 23139967 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 249 (C249F)

Ref Sequence

ENSEMBL: ENSMUSP00000028119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028119]

AlphaFold

Q8C0P0

Predicted Effect

probably damaging
Transcript: ENSMUST00000028119
AA Change: C249F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: C249F

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
Pfam:Pkinase_Tyr	34	194	2.6e-24	PFAM
Pfam:Pkinase	34	200	2.3e-39	PFAM
low complexity region	297	313	N/A	INTRINSIC
Pfam:Pkinase	710	821	6.4e-19	PFAM
Pfam:Pkinase_Tyr	714	818	5.1e-6	PFAM
S_TK_X	822	864	2.01e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136207

Meta Mutation Damage Score

0.2242

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	T	C	17: 24,281,314	Y1301C	possibly damaging	Het
Amfr	A	T	8: 94,005,214	N11K	probably damaging	Het
C87977	A	G	4: 144,209,622	S23P	probably benign	Het
Cadm3	A	G	1: 173,346,545	S34P	possibly damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Cdh23	C	T	10: 60,382,653		probably null	Het
Ceacam1	T	A	7: 25,474,017	I249F	probably damaging	Het
Cuzd1	C	T	7: 131,316,134	V246M	probably damaging	Het
Ehd2	A	T	7: 15,964,129	V61E	probably damaging	Het
Fam71b	T	C	11: 46,405,212	I137T	probably damaging	Het
Fibin	C	T	2: 110,362,197	R200H	probably damaging	Het
Fmo9	A	C	1: 166,673,667	F237C	probably damaging	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Iqgap3	C	A	3: 88,107,596	S873*	probably null	Het
Ism2	T	C	12: 87,299,663	M15V	unknown	Het
Itk	T	G	11: 46,344,835		probably benign	Het
Mink1	T	C	11: 70,612,508	V1143A	probably damaging	Het
Mrgprb4	T	A	7: 48,198,336	R281S	possibly damaging	Het
Mthfd1	T	C	12: 76,288,925	Y258H	probably damaging	Het
Ntmt1	A	G	2: 30,822,365	H140R	probably damaging	Het
Olfr139	C	T	11: 74,044,827	G149D	possibly damaging	Het
Olfr311	T	A	11: 58,841,882	V256E	probably benign	Het
Olfr340	T	C	2: 36,453,130	S182P	probably benign	Het
Olfr401	T	C	11: 74,121,982	I231T	probably damaging	Het
Parm1	A	G	5: 91,594,306	T178A	possibly damaging	Het
Patl1	T	C	19: 11,923,831	F282L	probably damaging	Het
Phospho2	T	C	2: 69,795,851	V117A	possibly damaging	Het
Ppp4r3a	T	C	12: 101,042,647		probably null	Het
Rbm17	A	G	2: 11,590,704	F230S	possibly damaging	Het
Robo3	C	A	9: 37,428,104	G196*	probably null	Het
Samhd1	A	G	2: 157,106,229		probably null	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Thbs4	A	G	13: 92,790,708	F91S	probably benign	Het
Trim34b	A	T	7: 104,336,232	N358I	probably benign	Het
Ulk1	A	G	5: 110,794,629	L255P	probably damaging	Het
Vmn2r104	T	A	17: 20,048,193	I5F	possibly damaging	Het
Vrk2	C	A	11: 26,483,324	S286I	possibly damaging	Het
Zswim3	T	C	2: 164,820,389	L263P	probably damaging	Het

Other mutations in Mastl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01080:Mastl	APN	2	23146148	missense	probably damaging	1.00
IGL02103:Mastl	APN	2	23139998	missense	probably benign	0.01
IGL02622:Mastl	APN	2	23132845	missense	probably benign	0.12
IGL02826:Mastl	APN	2	23145409	missense	probably damaging	1.00
IGL02896:Mastl	APN	2	23131767	missense	probably damaging	1.00
IGL03024:Mastl	APN	2	23139919	missense	probably damaging	1.00
IGL03038:Mastl	APN	2	23140615	splice site	probably benign
R0600:Mastl	UTSW	2	23133346	missense	probably benign	0.06
R0712:Mastl	UTSW	2	23150993	missense	probably damaging	1.00
R1168:Mastl	UTSW	2	23133132	missense	probably benign	0.06
R1750:Mastl	UTSW	2	23146081	nonsense	probably null
R1911:Mastl	UTSW	2	23132680	nonsense	probably null
R2051:Mastl	UTSW	2	23132824	missense	possibly damaging	0.49
R3799:Mastl	UTSW	2	23140492	splice site	probably benign
R3840:Mastl	UTSW	2	23140551	missense	probably damaging	1.00
R4807:Mastl	UTSW	2	23132843	missense	probably benign
R4818:Mastl	UTSW	2	23137026	missense	probably benign	0.00
R4845:Mastl	UTSW	2	23139998	missense	probably benign	0.01
R5338:Mastl	UTSW	2	23133491	missense	probably benign	0.01
R5364:Mastl	UTSW	2	23133653	missense	probably benign	0.16
R6077:Mastl	UTSW	2	23155794	missense	probably damaging	0.99
R6158:Mastl	UTSW	2	23132772	missense	possibly damaging	0.92
R6450:Mastl	UTSW	2	23120929	missense	probably damaging	1.00
R6602:Mastl	UTSW	2	23132677	missense	probably benign	0.04
R6788:Mastl	UTSW	2	23133698	missense	probably benign	0.22
R6908:Mastl	UTSW	2	23155976	start gained	probably benign
R7058:Mastl	UTSW	2	23133413	nonsense	probably null
R7233:Mastl	UTSW	2	23133658	missense	probably benign
R7249:Mastl	UTSW	2	23146139	missense	probably damaging	1.00
R7347:Mastl	UTSW	2	23133389	missense	probably damaging	0.99
R7371:Mastl	UTSW	2	23140573	missense	probably damaging	1.00
R7726:Mastl	UTSW	2	23140795	splice site	probably null
R8057:Mastl	UTSW	2	23133554	missense	possibly damaging	0.75
R8288:Mastl	UTSW	2	23133359	missense	probably damaging	1.00
R9101:Mastl	UTSW	2	23118437	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGAGTGCTACAGACTGTCTAAAG -3'
(R):5'- CTGAAGATGAAGCTCTTAGTACTTG -3'

Sequencing Primer
(F):5'- GGTGGCTCACAACCATCTGTAATG -3'
(R):5'- GAACGAGTCAGTTCTCCTTCCAG -3'

Posted On

2014-12-04