Incidental Mutation 'R2655:Crat'
ID252628
Institutional Source Beutler Lab
Gene Symbol Crat
Ensembl Gene ENSMUSG00000026853
Gene Namecarnitine acetyltransferase
SynonymsCARAT
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location30400471-30415813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30402691 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 115 (S115P)
Ref Sequence ENSEMBL: ENSMUSP00000114925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028207] [ENSMUST00000028209] [ENSMUST00000102854] [ENSMUST00000102855] [ENSMUST00000113612] [ENSMUST00000123202] [ENSMUST00000154595]
Predicted Effect probably damaging
Transcript: ENSMUST00000028207
AA Change: S590P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028207
Gene: ENSMUSG00000026853
AA Change: S590P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 34 616 1.9e-235 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028209
SMART Domains Protein: ENSMUSP00000028209
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
acidPPc 59 180 1.31e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102854
AA Change: S569P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099918
Gene: ENSMUSG00000026853
AA Change: S569P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 13 595 1.8e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102855
AA Change: S590P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099919
Gene: ENSMUSG00000026853
AA Change: S590P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 35 615 2.4e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113612
SMART Domains Protein: ENSMUSP00000109242
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
Pfam:PAP2 58 165 1.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123202
SMART Domains Protein: ENSMUSP00000119478
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
Pfam:PAP2 1 90 8.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133991
Predicted Effect probably benign
Transcript: ENSMUST00000137248
SMART Domains Protein: ENSMUSP00000116276
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
low complexity region 71 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152303
Predicted Effect probably damaging
Transcript: ENSMUST00000154595
AA Change: S115P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114925
Gene: ENSMUSG00000026853
AA Change: S115P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 132 1.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155196
SMART Domains Protein: ENSMUSP00000115602
Gene: ENSMUSG00000026856

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 69 88 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155790
AA Change: S164P
SMART Domains Protein: ENSMUSP00000122814
Gene: ENSMUSG00000026853
AA Change: S164P

DomainStartEndE-ValueType
Pfam:Carn_acyltransf 1 133 2.4e-51 PFAM
Pfam:Carn_acyltransf 128 190 8.9e-16 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes carnitine O-acetyltransferase, a member of the carnitine acyltransferase family and a key metabolic pathway enzyme which plays an important role in energy homeostasis and fat metabolism. This enzyme catalyzes the reversible transfer of acyl groups from an acyl-CoA thioester to carnitine and regulates the ratio of acyl-CoA/CoA. It is found in both the mitochondria and the peroxisome. Alternative splicing results in transcript variants encoding different isoforms that may localize to different subcellular compartments. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice with muscle specific loss of function display increased circulating glucose level, impaired glucose tolerance, insulin resistance, decreased circulating triglyceride and free fatty acid levels, increased susceptibility to diet-induced obesity and abnormal mitochondrial physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Crat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Crat APN 2 30405187 missense probably damaging 0.99
IGL01357:Crat APN 2 30407724 missense probably damaging 1.00
IGL01538:Crat APN 2 30409966 missense probably damaging 1.00
IGL01973:Crat APN 2 30405481 missense probably damaging 0.98
IGL02228:Crat APN 2 30413182 missense probably damaging 1.00
IGL02408:Crat APN 2 30407134 missense probably damaging 1.00
IGL02569:Crat APN 2 30404530 missense probably damaging 0.99
IGL02637:Crat APN 2 30406389 missense probably benign 0.06
IGL02983:Crat APN 2 30404526 critical splice donor site probably null
IGL03395:Crat APN 2 30404966 missense probably benign 0.11
Charlie UTSW 2 30403541 missense probably damaging 1.00
veruca UTSW 2 30403628 unclassified probably benign
R0136:Crat UTSW 2 30407030 missense probably benign
R0389:Crat UTSW 2 30403628 unclassified probably benign
R0443:Crat UTSW 2 30403628 unclassified probably benign
R0619:Crat UTSW 2 30409984 missense probably benign 0.14
R1938:Crat UTSW 2 30413061 missense probably benign
R1990:Crat UTSW 2 30405048 missense possibly damaging 0.93
R2113:Crat UTSW 2 30402642 missense probably benign 0.00
R3150:Crat UTSW 2 30413859 critical splice donor site probably null
R4231:Crat UTSW 2 30413011 missense possibly damaging 0.95
R4553:Crat UTSW 2 30408217 missense probably benign 0.00
R4592:Crat UTSW 2 30415366 utr 5 prime probably benign
R4718:Crat UTSW 2 30408164 nonsense probably null
R4808:Crat UTSW 2 30410021 missense probably benign 0.01
R4982:Crat UTSW 2 30407136 critical splice acceptor site probably null
R5473:Crat UTSW 2 30407714 missense probably damaging 1.00
R6049:Crat UTSW 2 30403541 missense probably damaging 1.00
R6223:Crat UTSW 2 30407030 missense probably benign 0.07
R6774:Crat UTSW 2 30413183 missense probably damaging 1.00
R6885:Crat UTSW 2 30415196 splice site probably benign
R7376:Crat UTSW 2 30406465 missense probably damaging 1.00
R7407:Crat UTSW 2 30404565 missense probably benign 0.01
R7408:Crat UTSW 2 30404565 missense probably benign 0.01
R7410:Crat UTSW 2 30404565 missense probably benign 0.01
R7467:Crat UTSW 2 30409982 missense probably damaging 1.00
R7484:Crat UTSW 2 30404565 missense probably benign 0.01
R7514:Crat UTSW 2 30404565 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTGAGCCATGGCAAGTGTC -3'
(R):5'- TCCCTCCAGGAATGTGAAGG -3'

Sequencing Primer
(F):5'- GCAAGTGTCCATCCCAAAGTGG -3'
(R):5'- TGTGAAGGAAGGCTCATCCTG -3'
Posted On2014-12-04