Incidental Mutation 'R2859:C87977'
ID 252631
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Name expressed sequence C87977
Synonyms
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 144206775-144213318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 144209622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 23 (S23P)
Ref Sequence ENSEMBL: ENSMUSP00000119895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect probably benign
Transcript: ENSMUST00000105753
AA Change: S21P

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000105754
AA Change: S21P

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000105755
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105757
AA Change: S21P

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: S21P

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect probably benign
Transcript: ENSMUST00000146836
Predicted Effect probably benign
Transcript: ENSMUST00000147855
AA Change: S23P

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1127:C87977 UTSW 4 144207124 missense probably damaging 1.00
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4130:C87977 UTSW 4 144208809 missense probably damaging 0.99
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4704:C87977 UTSW 4 144208592 missense probably damaging 1.00
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R5670:C87977 UTSW 4 144209622 missense probably benign 0.11
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R6528:C87977 UTSW 4 144208811 missense probably damaging 0.99
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R8737:C87977 UTSW 4 144208622 missense probably damaging 1.00
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGCAGGTATCATGGCCTTC -3'
(R):5'- GGCTTTAAAACCAGCAAAGGGC -3'

Sequencing Primer
(F):5'- GCAGGTATCATGGCCTTCAAGATC -3'
(R):5'- CAAGTCTCACTGAGGTCTAGGAC -3'
Posted On 2014-12-04