Incidental Mutation 'R2655:Reck'
ID252636
Institutional Source Beutler Lab
Gene Symbol Reck
Ensembl Gene ENSMUSG00000028476
Gene Namereversion-inducing-cysteine-rich protein with kazal motifs
SynonymsSt15
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43875530-43944806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43938966 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 777 (D777E)
Ref Sequence ENSEMBL: ENSMUSP00000030198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030198]
Predicted Effect probably benign
Transcript: ENSMUST00000030198
AA Change: D777E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030198
Gene: ENSMUSG00000028476
AA Change: D777E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 632 671 1.18e-2 SMART
KAZAL 708 750 1.46e-2 SMART
KAZAL 753 787 4.26e-2 SMART
low complexity region 877 890 N/A INTRINSIC
low complexity region 927 946 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130415
Meta Mutation Damage Score 0.0991 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Slu7 A G 11: 43,440,648 E203G probably benign Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Reck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Reck APN 4 43940662 missense probably damaging 1.00
IGL01569:Reck APN 4 43925172 missense probably benign 0.00
IGL02341:Reck APN 4 43925160 missense probably damaging 0.97
IGL02637:Reck APN 4 43898009 missense probably damaging 0.97
IGL02709:Reck APN 4 43913791 missense probably damaging 0.99
IGL02829:Reck APN 4 43891014 missense probably damaging 0.96
IGL02928:Reck APN 4 43912078 missense possibly damaging 0.47
IGL03132:Reck APN 4 43938898 nonsense probably null
PIT4453001:Reck UTSW 4 43895850 missense probably benign 0.00
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0607:Reck UTSW 4 43940719 missense probably benign 0.01
R0626:Reck UTSW 4 43930295 missense probably benign 0.00
R0894:Reck UTSW 4 43922967 missense probably damaging 1.00
R0932:Reck UTSW 4 43922838 missense possibly damaging 0.95
R1564:Reck UTSW 4 43912061 missense probably benign 0.00
R1633:Reck UTSW 4 43922964 missense possibly damaging 0.89
R1772:Reck UTSW 4 43890982 missense probably benign 0.00
R1968:Reck UTSW 4 43913771 splice site probably null
R2105:Reck UTSW 4 43943195 missense probably damaging 0.99
R2225:Reck UTSW 4 43922837 missense probably benign 0.01
R2302:Reck UTSW 4 43931015 missense probably benign 0.28
R2430:Reck UTSW 4 43930202 missense possibly damaging 0.88
R3858:Reck UTSW 4 43930261 missense probably benign 0.13
R4027:Reck UTSW 4 43922931 missense probably damaging 1.00
R4028:Reck UTSW 4 43922931 missense probably damaging 1.00
R4029:Reck UTSW 4 43922931 missense probably damaging 1.00
R4080:Reck UTSW 4 43942293 missense possibly damaging 0.95
R4497:Reck UTSW 4 43891001 missense probably benign
R4583:Reck UTSW 4 43931062 critical splice donor site probably null
R4702:Reck UTSW 4 43898060 missense probably damaging 1.00
R5934:Reck UTSW 4 43930979 missense probably damaging 1.00
R6114:Reck UTSW 4 43922895 missense probably damaging 1.00
R6235:Reck UTSW 4 43937450 missense probably damaging 1.00
X0062:Reck UTSW 4 43922921 missense probably damaging 1.00
X0067:Reck UTSW 4 43914016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCCAAAACTTAAACCTGTGTC -3'
(R):5'- ATTTCCTGGGGTGGATCAGC -3'

Sequencing Primer
(F):5'- TGTCTTTTAACTTCCTGAAAATAGGG -3'
(R):5'- TCCTGGGGTGGATCAGCAAATC -3'
Posted On2014-12-04