Incidental Mutation 'R2859:Mrgprb4'
ID 252643
Institutional Source Beutler Lab
Gene Symbol Mrgprb4
Ensembl Gene ENSMUSG00000070550
Gene Name MAS-related GPR, member B4
Synonyms MrgB4
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 48198070-48199288 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 48198336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 281 (R281S)
Ref Sequence ENSEMBL: ENSMUSP00000091952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094388]
AlphaFold Q91ZC0
Predicted Effect possibly damaging
Transcript: ENSMUST00000094388
AA Change: R281S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091952
Gene: ENSMUSG00000070550
AA Change: R281S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 37 215 6.4e-8 PFAM
Pfam:7tm_1 46 274 7.6e-12 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable, fertile and overtly normal with no apparent alterations in the pattern of axonal innervation of the epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 1814 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vmn2r104 T A 17: 20,048,193 I5F possibly damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Mrgprb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Mrgprb4 APN 7 48198901 missense probably benign
IGL02745:Mrgprb4 APN 7 48198358 missense probably damaging 0.97
R0718:Mrgprb4 UTSW 7 48198553 missense probably benign 0.10
R0849:Mrgprb4 UTSW 7 48199120 missense probably benign 0.24
R1526:Mrgprb4 UTSW 7 48198411 nonsense probably null
R2857:Mrgprb4 UTSW 7 48198336 missense possibly damaging 0.91
R4355:Mrgprb4 UTSW 7 48198701 missense possibly damaging 0.63
R5354:Mrgprb4 UTSW 7 48198329 missense probably benign 0.07
R5636:Mrgprb4 UTSW 7 48198470 missense probably benign 0.02
R5715:Mrgprb4 UTSW 7 48199039 missense probably damaging 1.00
R6180:Mrgprb4 UTSW 7 48198826 missense probably damaging 1.00
R6277:Mrgprb4 UTSW 7 48198901 missense probably benign
R7092:Mrgprb4 UTSW 7 48198236 missense probably benign 0.01
R7301:Mrgprb4 UTSW 7 48198758 missense probably damaging 0.99
R7779:Mrgprb4 UTSW 7 48199147 missense probably benign 0.19
R8077:Mrgprb4 UTSW 7 48198455 missense probably benign 0.00
R8292:Mrgprb4 UTSW 7 48198806 missense probably damaging 1.00
R8429:Mrgprb4 UTSW 7 48198425 missense probably benign 0.01
R9000:Mrgprb4 UTSW 7 48199021 missense probably damaging 1.00
R9006:Mrgprb4 UTSW 7 48198595 missense probably benign 0.12
R9106:Mrgprb4 UTSW 7 48198931 missense probably benign 0.43
R9717:Mrgprb4 UTSW 7 48198835 missense possibly damaging 0.96
Z1088:Mrgprb4 UTSW 7 48198682 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GTCAGTTTCTGTGTAACAAGCTC -3'
(R):5'- TTGCTCTCACAGTGGTGGTC -3'

Sequencing Primer
(F):5'- CAGTTTCTGTGTAACAAGCTCATTTC -3'
(R):5'- TCACAGTGGTGGTCTTCATATAC -3'
Posted On 2014-12-04