Incidental Mutation 'R2859:Cuzd1'
ID 252647
Institutional Source Beutler Lab
Gene Symbol Cuzd1
Ensembl Gene ENSMUSG00000040205
Gene Name CUB and zona pellucida-like domains 1
Synonyms ERG-1, UTCZP, UO-44, Itmap1
MMRRC Submission 040449-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 130910283-130924021 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 130917863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 246 (V246M)
Ref Sequence ENSEMBL: ENSMUSP00000037168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046611] [ENSMUST00000124096]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046611
AA Change: V246M

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037168
Gene: ENSMUSG00000040205
AA Change: V246M

DomainStartEndE-ValueType
CUB 32 146 1.78e-16 SMART
CUB 154 265 1.1e-44 SMART
ZP 276 519 1.39e-63 SMART
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Meta Mutation Damage Score 0.3346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Female mice homozygous for disruption of this gene exhibit impaired mammary gland development during puberty and during and following pregnancy and do not lactate. Homozygous mutant mice show an increased susceptibility to induced pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,500,288 (GRCm39) Y1301C possibly damaging Het
Amfr A T 8: 94,731,842 (GRCm39) N11K probably damaging Het
Cadm3 A G 1: 173,174,112 (GRCm39) S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdh23 C T 10: 60,218,432 (GRCm39) probably null Het
Ceacam1 T A 7: 25,173,442 (GRCm39) I249F probably damaging Het
Ehd2 A T 7: 15,698,054 (GRCm39) V61E probably damaging Het
Fibin C T 2: 110,192,542 (GRCm39) R200H probably damaging Het
Fmo9 A C 1: 166,501,236 (GRCm39) F237C probably damaging Het
Garin3 T C 11: 46,296,039 (GRCm39) I137T probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqgap3 C A 3: 88,014,903 (GRCm39) S873* probably null Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Itk T G 11: 46,235,662 (GRCm39) probably benign Het
Mastl C A 2: 23,029,979 (GRCm39) C249F probably damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Mrgprb4 T A 7: 47,848,084 (GRCm39) R281S possibly damaging Het
Mthfd1 T C 12: 76,335,699 (GRCm39) Y258H probably damaging Het
Ntmt1 A G 2: 30,712,377 (GRCm39) H140R probably damaging Het
Or1j12 T C 2: 36,343,142 (GRCm39) S182P probably benign Het
Or3a10 C T 11: 73,935,653 (GRCm39) G149D possibly damaging Het
Or3a1b T C 11: 74,012,808 (GRCm39) I231T probably damaging Het
Or9e1 T A 11: 58,732,708 (GRCm39) V256E probably benign Het
Parm1 A G 5: 91,742,165 (GRCm39) T178A possibly damaging Het
Patl1 T C 19: 11,901,195 (GRCm39) F282L probably damaging Het
Phospho2 T C 2: 69,626,195 (GRCm39) V117A possibly damaging Het
Ppp4r3a T C 12: 101,008,906 (GRCm39) probably null Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Rbm17 A G 2: 11,595,515 (GRCm39) F230S possibly damaging Het
Robo3 C A 9: 37,339,400 (GRCm39) G196* probably null Het
Samhd1 A G 2: 156,948,149 (GRCm39) probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Thbs4 A G 13: 92,927,216 (GRCm39) F91S probably benign Het
Trim34b A T 7: 103,985,439 (GRCm39) N358I probably benign Het
Ulk1 A G 5: 110,942,495 (GRCm39) L255P probably damaging Het
Vmn2r104 T A 17: 20,268,455 (GRCm39) I5F possibly damaging Het
Vrk2 C A 11: 26,433,324 (GRCm39) S286I possibly damaging Het
Zswim3 T C 2: 164,662,309 (GRCm39) L263P probably damaging Het
Other mutations in Cuzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Cuzd1 APN 7 130,917,865 (GRCm39) missense probably damaging 0.99
IGL01140:Cuzd1 APN 7 130,913,523 (GRCm39) missense probably damaging 1.00
IGL01773:Cuzd1 APN 7 130,916,614 (GRCm39) missense probably damaging 1.00
IGL02960:Cuzd1 APN 7 130,921,832 (GRCm39) missense probably benign 0.01
PIT4504001:Cuzd1 UTSW 7 130,911,529 (GRCm39) missense possibly damaging 0.88
R0233:Cuzd1 UTSW 7 130,913,545 (GRCm39) missense possibly damaging 0.61
R0233:Cuzd1 UTSW 7 130,913,545 (GRCm39) missense possibly damaging 0.61
R0363:Cuzd1 UTSW 7 130,917,991 (GRCm39) missense probably benign 0.16
R0375:Cuzd1 UTSW 7 130,913,637 (GRCm39) intron probably benign
R0446:Cuzd1 UTSW 7 130,918,009 (GRCm39) splice site probably null
R0482:Cuzd1 UTSW 7 130,911,601 (GRCm39) unclassified probably benign
R0765:Cuzd1 UTSW 7 130,917,824 (GRCm39) missense probably benign 0.40
R0932:Cuzd1 UTSW 7 130,921,923 (GRCm39) intron probably benign
R1463:Cuzd1 UTSW 7 130,918,371 (GRCm39) missense probably damaging 1.00
R1533:Cuzd1 UTSW 7 130,913,432 (GRCm39) missense probably damaging 0.99
R1722:Cuzd1 UTSW 7 130,913,373 (GRCm39) missense probably damaging 0.96
R1920:Cuzd1 UTSW 7 130,911,425 (GRCm39) missense probably benign 0.00
R2027:Cuzd1 UTSW 7 130,921,820 (GRCm39) missense possibly damaging 0.93
R2039:Cuzd1 UTSW 7 130,916,643 (GRCm39) intron probably benign
R2039:Cuzd1 UTSW 7 130,911,345 (GRCm39) missense probably benign 0.00
R2857:Cuzd1 UTSW 7 130,917,863 (GRCm39) missense probably damaging 0.97
R4585:Cuzd1 UTSW 7 130,916,529 (GRCm39) missense probably damaging 1.00
R4586:Cuzd1 UTSW 7 130,916,529 (GRCm39) missense probably damaging 1.00
R4830:Cuzd1 UTSW 7 130,919,783 (GRCm39) missense probably damaging 0.99
R4945:Cuzd1 UTSW 7 130,918,350 (GRCm39) missense probably damaging 1.00
R5009:Cuzd1 UTSW 7 130,913,252 (GRCm39) missense probably damaging 1.00
R5337:Cuzd1 UTSW 7 130,917,803 (GRCm39) missense probably damaging 1.00
R5355:Cuzd1 UTSW 7 130,917,853 (GRCm39) missense probably damaging 1.00
R6543:Cuzd1 UTSW 7 130,911,497 (GRCm39) missense probably damaging 1.00
R6569:Cuzd1 UTSW 7 130,913,486 (GRCm39) missense probably damaging 1.00
R6681:Cuzd1 UTSW 7 130,913,412 (GRCm39) missense probably damaging 1.00
R6818:Cuzd1 UTSW 7 130,918,394 (GRCm39) missense probably damaging 1.00
R6819:Cuzd1 UTSW 7 130,911,460 (GRCm39) missense possibly damaging 0.51
R7031:Cuzd1 UTSW 7 130,910,580 (GRCm39) missense probably benign 0.22
R7524:Cuzd1 UTSW 7 130,913,347 (GRCm39) missense probably damaging 0.97
R8328:Cuzd1 UTSW 7 130,913,345 (GRCm39) missense probably damaging 1.00
R8403:Cuzd1 UTSW 7 130,913,297 (GRCm39) missense probably damaging 1.00
R8425:Cuzd1 UTSW 7 130,919,720 (GRCm39) missense possibly damaging 0.54
R8519:Cuzd1 UTSW 7 130,910,626 (GRCm39) missense possibly damaging 0.47
R8879:Cuzd1 UTSW 7 130,910,577 (GRCm39) missense probably damaging 0.99
R8977:Cuzd1 UTSW 7 130,923,754 (GRCm39) missense probably benign 0.35
R9672:Cuzd1 UTSW 7 130,919,847 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTCCTCAAGCCTCCAGGTTAG -3'
(R):5'- TTGAAAAGCTCTTACACCAGAGG -3'

Sequencing Primer
(F):5'- TTCCCAAGTACATGACAGGTTGG -3'
(R):5'- AGCTCTTACACCAGAGGCTGTC -3'
Posted On 2014-12-04