Incidental Mutation 'R2859:Cd109'
ID 252653
Institutional Source Beutler Lab
Gene Symbol Cd109
Ensembl Gene ENSMUSG00000046186
Gene Name CD109 antigen
Synonyms Gov platelet alloantigens, 9930012E15Rik
MMRRC Submission 040449-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2859 (G1)
Quality Score 202
Status Validated
Chromosome 9
Chromosomal Location 78522828-78623535 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) CATTTATTTATTTATTTATTTATTTATTTATTTAT to CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT at 78619782 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093812]
AlphaFold Q8R422
Predicted Effect probably benign
Transcript: ENSMUST00000093812
SMART Domains Protein: ENSMUSP00000091330
Gene: ENSMUSG00000046186

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A2M_N 129 220 1.5e-16 PFAM
A2M_N_2 470 601 8.89e-32 SMART
A2M 695 786 2.07e-32 SMART
Pfam:Thiol-ester_cl 912 941 2.6e-20 PFAM
Pfam:A2M_comp 961 1197 1.9e-65 PFAM
low complexity region 1265 1275 N/A INTRINSIC
A2M_recep 1311 1395 2.06e-27 SMART
low complexity region 1422 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl phosphatidylinositol (GPI)-linked glycoprotein that localizes to the surface of platelets, activated T-cells, and endothelial cells. The protein binds to and negatively regulates signalling by transforming growth factor beta (TGF-beta). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a null mutation display epidermal hyperplasia and thickening, sebaceous gland hyperplasia and transient impairment of hair growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,500,288 (GRCm39) Y1301C possibly damaging Het
Amfr A T 8: 94,731,842 (GRCm39) N11K probably damaging Het
Cadm3 A G 1: 173,174,112 (GRCm39) S34P possibly damaging Het
Cdh23 C T 10: 60,218,432 (GRCm39) probably null Het
Ceacam1 T A 7: 25,173,442 (GRCm39) I249F probably damaging Het
Cuzd1 C T 7: 130,917,863 (GRCm39) V246M probably damaging Het
Ehd2 A T 7: 15,698,054 (GRCm39) V61E probably damaging Het
Fibin C T 2: 110,192,542 (GRCm39) R200H probably damaging Het
Fmo9 A C 1: 166,501,236 (GRCm39) F237C probably damaging Het
Garin3 T C 11: 46,296,039 (GRCm39) I137T probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqgap3 C A 3: 88,014,903 (GRCm39) S873* probably null Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Itk T G 11: 46,235,662 (GRCm39) probably benign Het
Mastl C A 2: 23,029,979 (GRCm39) C249F probably damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Mrgprb4 T A 7: 47,848,084 (GRCm39) R281S possibly damaging Het
Mthfd1 T C 12: 76,335,699 (GRCm39) Y258H probably damaging Het
Ntmt1 A G 2: 30,712,377 (GRCm39) H140R probably damaging Het
Or1j12 T C 2: 36,343,142 (GRCm39) S182P probably benign Het
Or3a10 C T 11: 73,935,653 (GRCm39) G149D possibly damaging Het
Or3a1b T C 11: 74,012,808 (GRCm39) I231T probably damaging Het
Or9e1 T A 11: 58,732,708 (GRCm39) V256E probably benign Het
Parm1 A G 5: 91,742,165 (GRCm39) T178A possibly damaging Het
Patl1 T C 19: 11,901,195 (GRCm39) F282L probably damaging Het
Phospho2 T C 2: 69,626,195 (GRCm39) V117A possibly damaging Het
Ppp4r3a T C 12: 101,008,906 (GRCm39) probably null Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Rbm17 A G 2: 11,595,515 (GRCm39) F230S possibly damaging Het
Robo3 C A 9: 37,339,400 (GRCm39) G196* probably null Het
Samhd1 A G 2: 156,948,149 (GRCm39) probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Thbs4 A G 13: 92,927,216 (GRCm39) F91S probably benign Het
Trim34b A T 7: 103,985,439 (GRCm39) N358I probably benign Het
Ulk1 A G 5: 110,942,495 (GRCm39) L255P probably damaging Het
Vmn2r104 T A 17: 20,268,455 (GRCm39) I5F possibly damaging Het
Vrk2 C A 11: 26,433,324 (GRCm39) S286I possibly damaging Het
Zswim3 T C 2: 164,662,309 (GRCm39) L263P probably damaging Het
Other mutations in Cd109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd109 APN 9 78,524,251 (GRCm39) missense probably damaging 1.00
IGL00465:Cd109 APN 9 78,568,216 (GRCm39) nonsense probably null
IGL00667:Cd109 APN 9 78,592,159 (GRCm39) missense probably damaging 0.99
IGL01432:Cd109 APN 9 78,605,405 (GRCm39) missense probably benign
IGL01795:Cd109 APN 9 78,569,047 (GRCm39) splice site probably benign
IGL02343:Cd109 APN 9 78,596,237 (GRCm39) splice site probably benign
IGL02450:Cd109 APN 9 78,603,132 (GRCm39) missense possibly damaging 0.83
IGL02699:Cd109 APN 9 78,579,271 (GRCm39) splice site probably benign
IGL02738:Cd109 APN 9 78,598,581 (GRCm39) missense probably damaging 1.00
IGL02797:Cd109 APN 9 78,568,995 (GRCm39) missense probably damaging 0.96
IGL03160:Cd109 APN 9 78,568,338 (GRCm39) splice site probably null
IGL03349:Cd109 APN 9 78,543,767 (GRCm39) missense probably benign 0.34
FR4589:Cd109 UTSW 9 78,619,811 (GRCm39) critical splice acceptor site probably benign
R0048:Cd109 UTSW 9 78,587,303 (GRCm39) missense possibly damaging 0.50
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0060:Cd109 UTSW 9 78,610,389 (GRCm39) missense probably damaging 1.00
R0158:Cd109 UTSW 9 78,596,214 (GRCm39) missense possibly damaging 0.49
R0415:Cd109 UTSW 9 78,619,897 (GRCm39) missense probably benign 0.13
R0659:Cd109 UTSW 9 78,587,452 (GRCm39) splice site probably benign
R0709:Cd109 UTSW 9 78,579,260 (GRCm39) missense possibly damaging 0.93
R0840:Cd109 UTSW 9 78,571,612 (GRCm39) missense probably benign 0.04
R0909:Cd109 UTSW 9 78,543,755 (GRCm39) missense probably benign 0.01
R0945:Cd109 UTSW 9 78,596,223 (GRCm39) missense possibly damaging 0.51
R1344:Cd109 UTSW 9 78,579,832 (GRCm39) critical splice acceptor site probably null
R1471:Cd109 UTSW 9 78,561,869 (GRCm39) missense probably damaging 1.00
R1484:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1570:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R1688:Cd109 UTSW 9 78,612,373 (GRCm39) missense probably benign 0.17
R1773:Cd109 UTSW 9 78,611,006 (GRCm39) missense probably benign 0.21
R1813:Cd109 UTSW 9 78,524,287 (GRCm39) missense probably benign 0.04
R2004:Cd109 UTSW 9 78,611,044 (GRCm39) missense probably benign 0.00
R2083:Cd109 UTSW 9 78,574,575 (GRCm39) missense probably damaging 1.00
R2483:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R2857:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2858:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2911:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2912:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2914:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R2927:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3623:Cd109 UTSW 9 78,574,639 (GRCm39) missense probably damaging 1.00
R3713:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3760:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3762:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3771:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3772:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3916:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R3917:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4117:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4260:Cd109 UTSW 9 78,543,745 (GRCm39) missense possibly damaging 0.67
R4387:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4389:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4526:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4527:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4528:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4700:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4708:Cd109 UTSW 9 78,579,871 (GRCm39) missense probably benign 0.00
R4723:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4750:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4751:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4754:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4755:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4773:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R4984:Cd109 UTSW 9 78,541,959 (GRCm39) critical splice donor site probably null
R5259:Cd109 UTSW 9 78,617,434 (GRCm39) missense probably benign 0.30
R5353:Cd109 UTSW 9 78,617,521 (GRCm39) missense probably damaging 1.00
R5440:Cd109 UTSW 9 78,587,446 (GRCm39) critical splice donor site probably null
R5559:Cd109 UTSW 9 78,568,250 (GRCm39) missense probably benign 0.01
R5701:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R5995:Cd109 UTSW 9 78,607,561 (GRCm39) missense probably benign 0.01
R5997:Cd109 UTSW 9 78,612,344 (GRCm39) missense possibly damaging 0.93
R6103:Cd109 UTSW 9 78,605,596 (GRCm39) splice site probably null
R6174:Cd109 UTSW 9 78,572,828 (GRCm39) critical splice donor site probably null
R6410:Cd109 UTSW 9 78,564,798 (GRCm39) missense probably benign 0.01
R6529:Cd109 UTSW 9 78,619,907 (GRCm39) missense probably damaging 1.00
R6655:Cd109 UTSW 9 78,592,220 (GRCm39) missense probably benign 0.44
R6704:Cd109 UTSW 9 78,587,357 (GRCm39) missense probably benign 0.01
R6772:Cd109 UTSW 9 78,588,092 (GRCm39) missense possibly damaging 0.55
R6817:Cd109 UTSW 9 78,622,237 (GRCm39) missense probably benign 0.01
R6903:Cd109 UTSW 9 78,543,885 (GRCm39) missense probably damaging 0.97
R7294:Cd109 UTSW 9 78,619,917 (GRCm39) missense probably damaging 0.97
R7432:Cd109 UTSW 9 78,622,225 (GRCm39) missense possibly damaging 0.85
R7566:Cd109 UTSW 9 78,588,119 (GRCm39) missense probably damaging 1.00
R7767:Cd109 UTSW 9 78,617,441 (GRCm39) missense probably damaging 1.00
R7986:Cd109 UTSW 9 78,596,048 (GRCm39) missense possibly damaging 0.95
R8017:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8019:Cd109 UTSW 9 78,614,828 (GRCm39) missense possibly damaging 0.81
R8050:Cd109 UTSW 9 78,571,633 (GRCm39) missense probably benign 0.28
R8225:Cd109 UTSW 9 78,568,972 (GRCm39) missense probably damaging 0.99
R8269:Cd109 UTSW 9 78,572,964 (GRCm39) missense probably benign 0.06
R8479:Cd109 UTSW 9 78,574,628 (GRCm39) nonsense probably null
R8493:Cd109 UTSW 9 78,564,801 (GRCm39) missense probably benign 0.41
R8781:Cd109 UTSW 9 78,543,929 (GRCm39) missense probably damaging 1.00
R8977:Cd109 UTSW 9 78,614,810 (GRCm39) missense probably benign 0.36
R9051:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
R9051:Cd109 UTSW 9 78,619,782 (GRCm39) critical splice acceptor site probably benign
R9228:Cd109 UTSW 9 78,577,042 (GRCm39) missense possibly damaging 0.93
R9366:Cd109 UTSW 9 78,622,275 (GRCm39) missense probably benign 0.11
R9430:Cd109 UTSW 9 78,574,698 (GRCm39) critical splice donor site probably null
R9572:Cd109 UTSW 9 78,567,588 (GRCm39) missense probably benign 0.16
R9691:Cd109 UTSW 9 78,611,074 (GRCm39) missense possibly damaging 0.94
R9736:Cd109 UTSW 9 78,619,918 (GRCm39) missense probably damaging 1.00
R9749:Cd109 UTSW 9 78,592,166 (GRCm39) missense probably damaging 1.00
R9751:Cd109 UTSW 9 78,605,442 (GRCm39) missense probably damaging 0.99
R9752:Cd109 UTSW 9 78,614,834 (GRCm39) missense probably benign 0.00
R9789:Cd109 UTSW 9 78,541,944 (GRCm39) missense possibly damaging 0.90
R9797:Cd109 UTSW 9 78,579,217 (GRCm39) missense probably benign 0.04
RF002:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF002:Cd109 UTSW 9 78,619,805 (GRCm39) critical splice acceptor site probably benign
RF003:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF011:Cd109 UTSW 9 78,619,810 (GRCm39) critical splice acceptor site probably benign
RF013:Cd109 UTSW 9 78,619,813 (GRCm39) critical splice acceptor site probably benign
RF047:Cd109 UTSW 9 78,619,809 (GRCm39) critical splice acceptor site probably benign
RF060:Cd109 UTSW 9 78,619,807 (GRCm39) critical splice acceptor site probably benign
Z1177:Cd109 UTSW 9 78,598,595 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCATCCCTTTAGTAGACGGGG -3'
(R):5'- GCCTGCCTTGATTCCCAAAG -3'

Sequencing Primer
(F):5'- GGGGACTAAGAACCATTCCTCTG -3'
(R):5'- GCCTTGATTCCCAAAGTCTTAGAAAC -3'
Posted On 2014-12-04