Mutagenetix > Incidental Mutations

Incidental Mutation 'R2655:Vmn2r72'

252656

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r72

Ensembl Gene

ENSMUSG00000051877

Gene Name

vomeronasal 2, receptor 72

Synonyms

Vmn2r72-ps, EG244114

MMRRC Submission

040430-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R2655 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85737784-85754981 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85751269 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 191 (T191A)

Ref Sequence

ENSEMBL: ENSMUSP00000133014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063425]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063425
AA Change: T191A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: T191A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	82	469	2.3e-28	PFAM
Pfam:NCD3G	512	564	1.2e-18	PFAM
Pfam:7tm_3	594	832	4e-53	PFAM

Meta Mutation Damage Score

0.0628

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (39/39)

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot5	T	A	12: 84,075,876	S411R	probably benign	Het
Adamts12	A	T	15: 11,065,088	N20Y	possibly damaging	Het
Bbs9	G	A	9: 22,504,052	E91K	probably damaging	Het
Casp4	C	A	9: 5,322,894	L57I	possibly damaging	Het
Cat	T	C	2: 103,471,846	K169E	probably damaging	Het
Cav1	A	G	6: 17,339,360	Y148C	probably damaging	Het
Cep112	T	C	11: 108,437,201		probably benign	Het
Chaf1b	T	C	16: 93,891,511	S165P	probably damaging	Het
Crat	A	G	2: 30,402,691	S115P	probably damaging	Het
Eif2b1	A	G	5: 124,576,854	S120P	probably damaging	Het
Epor	A	G	9: 21,960,720	S236P	probably damaging	Het
Ggt1	T	A	10: 75,581,385	Y5*	probably null	Het
Igfbpl1	T	C	4: 45,816,289	T179A	probably damaging	Het
Ighv14-4	T	G	12: 114,176,448	Y114S	probably damaging	Het
Ipcef1	T	C	10: 6,979,657	I29V	probably benign	Het
Junb	A	G	8: 84,977,508	S308P	probably damaging	Het
Kcnh5	T	C	12: 75,114,540	E198G	probably damaging	Het
Ltbp1	G	A	17: 75,005,983	R33H	possibly damaging	Het
Map3k20	C	A	2: 72,433,420	T471K	probably damaging	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr642	T	C	7: 104,049,431	M308V	probably benign	Het
Olfr955	A	T	9: 39,470,628	S33T	probably benign	Het
Patj	T	C	4: 98,437,450	V508A	possibly damaging	Het
Pkd1	T	C	17: 24,576,490	V2319A	probably damaging	Het
Pnpla7	A	G	2: 25,052,318	Y83C	probably damaging	Het
Prb1	G	C	6: 132,210,462	Q19E	unknown	Het
Rasa3	T	C	8: 13,595,373	T189A	possibly damaging	Het
Reck	T	A	4: 43,938,966	D777E	probably benign	Het
Rfx6	A	G	10: 51,693,777		probably benign	Het
Serpinb13	A	G	1: 107,000,427	D259G	probably damaging	Het
Slit2	G	A	5: 48,189,575	R253Q	possibly damaging	Het
Slu7	A	G	11: 43,440,648	E203G	probably benign	Het
Syt4	A	T	18: 31,443,544	D252E	probably benign	Het
Tpte	A	G	8: 22,311,278		probably null	Het
Ttc25	T	A	11: 100,553,579	W237R	probably damaging	Het
Ttll7	A	G	3: 146,947,621	Y729C	probably damaging	Het
Usp35	T	A	7: 97,312,147	T691S	probably benign	Het
Vmn1r211	A	G	13: 22,852,416	V27A	probably benign	Het
Vwa5b1	C	T	4: 138,594,303	G393D	probably damaging	Het

Other mutations in Vmn2r72

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00931:Vmn2r72	APN	7	85749646	missense	probably benign	0.01
IGL01019:Vmn2r72	APN	7	85738334	missense	probably benign	0.26
IGL01445:Vmn2r72	APN	7	85749646	missense	probably benign	0.06
IGL02076:Vmn2r72	APN	7	85738367	missense	probably damaging	1.00
IGL02082:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02086:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02089:Vmn2r72	APN	7	85738166	missense	probably benign	0.00
IGL02125:Vmn2r72	APN	7	85750711	missense	probably benign	0.00
IGL02146:Vmn2r72	APN	7	85737962	missense	probably damaging	1.00
IGL02272:Vmn2r72	APN	7	85750693	missense	probably benign
IGL02514:Vmn2r72	APN	7	85738699	missense	possibly damaging	0.90
IGL02662:Vmn2r72	APN	7	85738183	missense	probably benign	0.26
IGL02697:Vmn2r72	APN	7	85738671	missense	probably benign	0.36
IGL02733:Vmn2r72	APN	7	85751813	missense	probably benign	0.05
IGL03070:Vmn2r72	APN	7	85752041	splice site	probably benign
IGL03150:Vmn2r72	APN	7	85751176	missense	probably damaging	1.00
IGL03159:Vmn2r72	APN	7	85754954	missense	probably benign	0.05
IGL03333:Vmn2r72	APN	7	85750867	missense	probably benign	0.10
R0081:Vmn2r72	UTSW	7	85751836	missense	probably benign	0.01
R0090:Vmn2r72	UTSW	7	85754876	missense	probably benign
R0655:Vmn2r72	UTSW	7	85738111	nonsense	probably null
R0778:Vmn2r72	UTSW	7	85749739	missense	probably benign	0.00
R1169:Vmn2r72	UTSW	7	85751309	missense	probably benign	0.01
R1172:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1173:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1175:Vmn2r72	UTSW	7	85751944	missense	probably damaging	1.00
R1248:Vmn2r72	UTSW	7	85749188	missense	probably benign	0.02
R1302:Vmn2r72	UTSW	7	85738257	missense	probably damaging	1.00
R1506:Vmn2r72	UTSW	7	85749211	missense	probably benign
R1632:Vmn2r72	UTSW	7	85751792	missense	probably benign	0.13
R1775:Vmn2r72	UTSW	7	85738170	missense	probably benign	0.01
R1962:Vmn2r72	UTSW	7	85749161	missense	probably benign	0.00
R2201:Vmn2r72	UTSW	7	85738236	missense	probably benign	0.12
R2290:Vmn2r72	UTSW	7	85738341	missense	probably damaging	1.00
R2327:Vmn2r72	UTSW	7	85738256	missense	probably damaging	1.00
R2424:Vmn2r72	UTSW	7	85750953	missense	probably damaging	1.00
R2860:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2861:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R2862:Vmn2r72	UTSW	7	85750836	missense	probably damaging	0.99
R3009:Vmn2r72	UTSW	7	85749642	missense	probably benign	0.00
R3797:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3798:Vmn2r72	UTSW	7	85738077	missense	probably benign	0.44
R3902:Vmn2r72	UTSW	7	85749735	missense	possibly damaging	0.52
R3959:Vmn2r72	UTSW	7	85751131	missense	probably benign	0.36
R3974:Vmn2r72	UTSW	7	85749809	missense	probably damaging	1.00
R4399:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4421:Vmn2r72	UTSW	7	85738500	missense	probably damaging	1.00
R4426:Vmn2r72	UTSW	7	85737828	nonsense	probably null
R4522:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4523:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4533:Vmn2r72	UTSW	7	85751926	missense	probably benign	0.44
R4691:Vmn2r72	UTSW	7	85737911	nonsense	probably null
R4781:Vmn2r72	UTSW	7	85737861	missense	probably benign	0.14
R4863:Vmn2r72	UTSW	7	85750598	missense	possibly damaging	0.91
R4952:Vmn2r72	UTSW	7	85751109	missense	probably benign
R4991:Vmn2r72	UTSW	7	85751130	missense	probably damaging	0.99
R4995:Vmn2r72	UTSW	7	85738485	missense	probably damaging	1.00
R5095:Vmn2r72	UTSW	7	85737853	missense	probably damaging	0.98
R5174:Vmn2r72	UTSW	7	85737840	missense	probably benign	0.00
R5276:Vmn2r72	UTSW	7	85738254	missense	possibly damaging	0.90
R5395:Vmn2r72	UTSW	7	85750897	missense	possibly damaging	0.71
R5560:Vmn2r72	UTSW	7	85751942	missense	probably damaging	0.96
R5933:Vmn2r72	UTSW	7	85737850	missense	probably benign	0.05
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6033:Vmn2r72	UTSW	7	85737929	missense	probably damaging	1.00
R6354:Vmn2r72	UTSW	7	85750539	critical splice donor site	probably null
R6362:Vmn2r72	UTSW	7	85751174	missense	probably damaging	1.00
R6594:Vmn2r72	UTSW	7	85749684	missense	probably benign	0.32
R6794:Vmn2r72	UTSW	7	85737996	missense	probably damaging	1.00
R7113:Vmn2r72	UTSW	7	85749803	synonymous	probably null
R7189:Vmn2r72	UTSW	7	85754917	missense	probably benign	0.36
R7266:Vmn2r72	UTSW	7	85738274	nonsense	probably null
R7323:Vmn2r72	UTSW	7	85750563	missense	probably benign
R7426:Vmn2r72	UTSW	7	85751140	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATGCTCAGTTAGGATAGCAAACAC -3'
(R):5'- GCATGGGAGTCAGCAACATTG -3'

Sequencing Primer
(F):5'- CTCAGTTAGGATAGCAAACACAAATG -3'
(R):5'- TGGGAGTCAGCAACATTGTGAAATG -3'

Posted On

2014-12-04