Incidental Mutation 'R2859:Ppp4r3a'
ID 252673
Institutional Source Beutler Lab
Gene Symbol Ppp4r3a
Ensembl Gene ENSMUSG00000041846
Gene Name protein phosphatase 4 regulatory subunit 3A
Synonyms 1110034C04Rik, Smek1
MMRRC Submission 040449-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.351) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 101005668-101049961 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to C at 101008906 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000048305] [ENSMUST00000163095] [ENSMUST00000163095] [ENSMUST00000223091]
AlphaFold Q6P2K6
Predicted Effect probably null
Transcript: ENSMUST00000048305
SMART Domains Protein: ENSMUSP00000041667
Gene: ENSMUSG00000041846

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 3e-24 SMART
Pfam:SMK-1 164 357 5.8e-85 PFAM
low complexity region 407 418 N/A INTRINSIC
low complexity region 495 503 N/A INTRINSIC
low complexity region 705 720 N/A INTRINSIC
low complexity region 753 770 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163095
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163095
SMART Domains Protein: ENSMUSP00000129654
Gene: ENSMUSG00000041846

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 4e-24 SMART
Pfam:SMK-1 166 357 2.5e-84 PFAM
low complexity region 508 516 N/A INTRINSIC
low complexity region 718 733 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 808 821 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222956
Predicted Effect probably benign
Transcript: ENSMUST00000223091
Predicted Effect probably null
Transcript: ENSMUST00000223459
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,500,288 (GRCm39) Y1301C possibly damaging Het
Amfr A T 8: 94,731,842 (GRCm39) N11K probably damaging Het
Cadm3 A G 1: 173,174,112 (GRCm39) S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdh23 C T 10: 60,218,432 (GRCm39) probably null Het
Ceacam1 T A 7: 25,173,442 (GRCm39) I249F probably damaging Het
Cuzd1 C T 7: 130,917,863 (GRCm39) V246M probably damaging Het
Ehd2 A T 7: 15,698,054 (GRCm39) V61E probably damaging Het
Fibin C T 2: 110,192,542 (GRCm39) R200H probably damaging Het
Fmo9 A C 1: 166,501,236 (GRCm39) F237C probably damaging Het
Garin3 T C 11: 46,296,039 (GRCm39) I137T probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqgap3 C A 3: 88,014,903 (GRCm39) S873* probably null Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Itk T G 11: 46,235,662 (GRCm39) probably benign Het
Mastl C A 2: 23,029,979 (GRCm39) C249F probably damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Mrgprb4 T A 7: 47,848,084 (GRCm39) R281S possibly damaging Het
Mthfd1 T C 12: 76,335,699 (GRCm39) Y258H probably damaging Het
Ntmt1 A G 2: 30,712,377 (GRCm39) H140R probably damaging Het
Or1j12 T C 2: 36,343,142 (GRCm39) S182P probably benign Het
Or3a10 C T 11: 73,935,653 (GRCm39) G149D possibly damaging Het
Or3a1b T C 11: 74,012,808 (GRCm39) I231T probably damaging Het
Or9e1 T A 11: 58,732,708 (GRCm39) V256E probably benign Het
Parm1 A G 5: 91,742,165 (GRCm39) T178A possibly damaging Het
Patl1 T C 19: 11,901,195 (GRCm39) F282L probably damaging Het
Phospho2 T C 2: 69,626,195 (GRCm39) V117A possibly damaging Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Rbm17 A G 2: 11,595,515 (GRCm39) F230S possibly damaging Het
Robo3 C A 9: 37,339,400 (GRCm39) G196* probably null Het
Samhd1 A G 2: 156,948,149 (GRCm39) probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Thbs4 A G 13: 92,927,216 (GRCm39) F91S probably benign Het
Trim34b A T 7: 103,985,439 (GRCm39) N358I probably benign Het
Ulk1 A G 5: 110,942,495 (GRCm39) L255P probably damaging Het
Vmn2r104 T A 17: 20,268,455 (GRCm39) I5F possibly damaging Het
Vrk2 C A 11: 26,433,324 (GRCm39) S286I possibly damaging Het
Zswim3 T C 2: 164,662,309 (GRCm39) L263P probably damaging Het
Other mutations in Ppp4r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ppp4r3a APN 12 101,016,053 (GRCm39) missense probably damaging 1.00
IGL00532:Ppp4r3a APN 12 101,010,912 (GRCm39) missense probably damaging 1.00
IGL01359:Ppp4r3a APN 12 101,024,755 (GRCm39) missense probably damaging 0.99
IGL01873:Ppp4r3a APN 12 101,008,094 (GRCm39) missense possibly damaging 0.86
IGL02676:Ppp4r3a APN 12 101,008,770 (GRCm39) missense probably benign 0.00
IGL02756:Ppp4r3a APN 12 101,024,582 (GRCm39) critical splice donor site probably null
IGL03196:Ppp4r3a APN 12 101,015,913 (GRCm39) splice site probably benign
IGL03206:Ppp4r3a APN 12 101,024,878 (GRCm39) missense probably damaging 1.00
R1101:Ppp4r3a UTSW 12 101,017,830 (GRCm39) missense probably damaging 0.98
R1434:Ppp4r3a UTSW 12 101,009,783 (GRCm39) missense probably damaging 0.99
R1526:Ppp4r3a UTSW 12 101,007,000 (GRCm39) missense probably damaging 0.99
R1554:Ppp4r3a UTSW 12 101,022,081 (GRCm39) missense probably damaging 1.00
R1650:Ppp4r3a UTSW 12 101,010,878 (GRCm39) missense probably damaging 0.99
R1766:Ppp4r3a UTSW 12 101,024,741 (GRCm39) missense probably damaging 0.99
R2152:Ppp4r3a UTSW 12 101,008,826 (GRCm39) missense probably damaging 0.99
R2322:Ppp4r3a UTSW 12 101,008,878 (GRCm39) missense probably damaging 0.98
R2421:Ppp4r3a UTSW 12 101,008,912 (GRCm39) splice site probably benign
R2422:Ppp4r3a UTSW 12 101,008,912 (GRCm39) splice site probably benign
R2884:Ppp4r3a UTSW 12 101,034,936 (GRCm39) missense probably damaging 0.99
R4157:Ppp4r3a UTSW 12 101,021,878 (GRCm39) missense probably damaging 0.97
R4651:Ppp4r3a UTSW 12 101,049,170 (GRCm39) utr 5 prime probably benign
R4652:Ppp4r3a UTSW 12 101,049,170 (GRCm39) utr 5 prime probably benign
R4706:Ppp4r3a UTSW 12 101,008,175 (GRCm39) missense probably damaging 1.00
R4773:Ppp4r3a UTSW 12 101,049,026 (GRCm39) missense possibly damaging 0.93
R4775:Ppp4r3a UTSW 12 101,019,825 (GRCm39) missense probably damaging 0.99
R5467:Ppp4r3a UTSW 12 101,009,729 (GRCm39) missense probably damaging 0.99
R5634:Ppp4r3a UTSW 12 101,009,780 (GRCm39) missense probably damaging 1.00
R5704:Ppp4r3a UTSW 12 101,049,619 (GRCm39) utr 5 prime probably benign
R5707:Ppp4r3a UTSW 12 101,024,770 (GRCm39) missense probably damaging 1.00
R5935:Ppp4r3a UTSW 12 101,017,872 (GRCm39) missense probably damaging 1.00
R5969:Ppp4r3a UTSW 12 101,009,838 (GRCm39) missense probably benign
R6030:Ppp4r3a UTSW 12 101,024,659 (GRCm39) missense probably damaging 0.97
R6030:Ppp4r3a UTSW 12 101,024,659 (GRCm39) missense probably damaging 0.97
R6630:Ppp4r3a UTSW 12 101,016,035 (GRCm39) missense probably damaging 1.00
R7265:Ppp4r3a UTSW 12 101,019,770 (GRCm39) missense possibly damaging 0.77
R7352:Ppp4r3a UTSW 12 101,008,091 (GRCm39) missense probably damaging 1.00
R7402:Ppp4r3a UTSW 12 101,025,053 (GRCm39) missense possibly damaging 0.94
R7761:Ppp4r3a UTSW 12 101,022,080 (GRCm39) missense probably damaging 0.98
R7808:Ppp4r3a UTSW 12 101,019,755 (GRCm39) missense possibly damaging 0.94
R7811:Ppp4r3a UTSW 12 101,019,821 (GRCm39) missense probably damaging 0.98
R8062:Ppp4r3a UTSW 12 101,008,230 (GRCm39) missense probably damaging 0.98
R8222:Ppp4r3a UTSW 12 101,008,164 (GRCm39) missense probably benign 0.09
R8409:Ppp4r3a UTSW 12 101,008,752 (GRCm39) missense probably benign 0.02
R8435:Ppp4r3a UTSW 12 101,049,048 (GRCm39) missense probably benign 0.19
R8471:Ppp4r3a UTSW 12 101,021,901 (GRCm39) missense probably benign 0.01
R9010:Ppp4r3a UTSW 12 101,024,591 (GRCm39) missense possibly damaging 0.58
R9137:Ppp4r3a UTSW 12 101,021,794 (GRCm39) missense possibly damaging 0.95
R9335:Ppp4r3a UTSW 12 101,007,013 (GRCm39) missense probably damaging 1.00
R9336:Ppp4r3a UTSW 12 101,015,919 (GRCm39) missense probably benign
R9666:Ppp4r3a UTSW 12 101,049,129 (GRCm39) start codon destroyed probably null 0.39
R9752:Ppp4r3a UTSW 12 101,008,763 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGAGCCTCACTTTCCCTTG -3'
(R):5'- GCCTCTGTCTCTGTAGTATGGC -3'

Sequencing Primer
(F):5'- TGCTCTTTGTTTCAACATACATTTC -3'
(R):5'- GTCTCTGTAGTATGGCTTAAAAGTC -3'
Posted On 2014-12-04