Incidental Mutation 'R2859:Vmn2r104'
ID252679
Institutional Source Beutler Lab
Gene Symbol Vmn2r104
Ensembl Gene ENSMUSG00000090315
Gene Namevomeronasal 2, receptor 104
SynonymsV2r7
MMRRC Submission 040449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R2859 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20029425-20048205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20048193 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 5 (I5F)
Ref Sequence ENSEMBL: ENSMUSP00000129895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168050]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168050
AA Change: I5F

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129895
Gene: ENSMUSG00000090315
AA Change: I5F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 85 457 4e-38 PFAM
Pfam:NCD3G 512 565 2.1e-20 PFAM
Pfam:7tm_3 598 833 1.7e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,314 Y1301C possibly damaging Het
Amfr A T 8: 94,005,214 N11K probably damaging Het
C87977 A G 4: 144,209,622 S23P probably benign Het
Cadm3 A G 1: 173,346,545 S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh23 C T 10: 60,382,653 probably null Het
Ceacam1 T A 7: 25,474,017 I249F probably damaging Het
Cuzd1 C T 7: 131,316,134 V246M probably damaging Het
Ehd2 A T 7: 15,964,129 V61E probably damaging Het
Fam71b T C 11: 46,405,212 I137T probably damaging Het
Fibin C T 2: 110,362,197 R200H probably damaging Het
Fmo9 A C 1: 166,673,667 F237C probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Iqgap3 C A 3: 88,107,596 S873* probably null Het
Ism2 T C 12: 87,299,663 M15V unknown Het
Itk T G 11: 46,344,835 probably benign Het
Mastl C A 2: 23,139,967 C249F probably damaging Het
Mink1 T C 11: 70,612,508 V1143A probably damaging Het
Mrgprb4 T A 7: 48,198,336 R281S possibly damaging Het
Mthfd1 T C 12: 76,288,925 Y258H probably damaging Het
Ntmt1 A G 2: 30,822,365 H140R probably damaging Het
Olfr139 C T 11: 74,044,827 G149D possibly damaging Het
Olfr311 T A 11: 58,841,882 V256E probably benign Het
Olfr340 T C 2: 36,453,130 S182P probably benign Het
Olfr401 T C 11: 74,121,982 I231T probably damaging Het
Parm1 A G 5: 91,594,306 T178A possibly damaging Het
Patl1 T C 19: 11,923,831 F282L probably damaging Het
Phospho2 T C 2: 69,795,851 V117A possibly damaging Het
Ppp4r3a T C 12: 101,042,647 probably null Het
Rbm17 A G 2: 11,590,704 F230S possibly damaging Het
Robo3 C A 9: 37,428,104 G196* probably null Het
Samhd1 A G 2: 157,106,229 probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Thbs4 A G 13: 92,790,708 F91S probably benign Het
Trim34b A T 7: 104,336,232 N358I probably benign Het
Ulk1 A G 5: 110,794,629 L255P probably damaging Het
Vrk2 C A 11: 26,483,324 S286I possibly damaging Het
Zswim3 T C 2: 164,820,389 L263P probably damaging Het
Other mutations in Vmn2r104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn2r104 APN 17 20038239 missense probably damaging 0.98
IGL01098:Vmn2r104 APN 17 20048096 missense probably benign 0.27
IGL01333:Vmn2r104 APN 17 20042793 missense probably benign 0.17
IGL01527:Vmn2r104 APN 17 20042896 missense possibly damaging 0.82
IGL01773:Vmn2r104 APN 17 20040668 missense probably benign 0.10
IGL01939:Vmn2r104 APN 17 20029925 missense probably damaging 0.99
IGL02121:Vmn2r104 APN 17 20041794 nonsense probably null
IGL02305:Vmn2r104 APN 17 20042856 missense probably benign 0.09
IGL02374:Vmn2r104 APN 17 20042786 missense probably benign 0.34
IGL03260:Vmn2r104 APN 17 20042821 missense probably benign 0.05
IGL03366:Vmn2r104 APN 17 20029604 missense probably damaging 1.00
R0091:Vmn2r104 UTSW 17 20041813 missense possibly damaging 0.79
R0125:Vmn2r104 UTSW 17 20029807 missense probably damaging 0.98
R0257:Vmn2r104 UTSW 17 20029627 missense probably damaging 1.00
R0381:Vmn2r104 UTSW 17 20048002 nonsense probably null
R0709:Vmn2r104 UTSW 17 20042904 missense probably damaging 1.00
R0786:Vmn2r104 UTSW 17 20042725 missense probably benign
R1575:Vmn2r104 UTSW 17 20042215 missense probably damaging 1.00
R1827:Vmn2r104 UTSW 17 20042235 missense probably damaging 0.97
R1932:Vmn2r104 UTSW 17 20040769 missense probably damaging 1.00
R1956:Vmn2r104 UTSW 17 20042051 missense probably damaging 0.98
R2203:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R2205:Vmn2r104 UTSW 17 20029821 missense probably benign 0.05
R3701:Vmn2r104 UTSW 17 20029556 missense probably damaging 1.00
R3834:Vmn2r104 UTSW 17 20029921 missense probably benign 0.02
R4151:Vmn2r104 UTSW 17 20029885 missense probably damaging 1.00
R4470:Vmn2r104 UTSW 17 20042241 missense probably damaging 1.00
R4625:Vmn2r104 UTSW 17 20048181 missense probably benign 0.00
R4754:Vmn2r104 UTSW 17 20040768 nonsense probably null
R4911:Vmn2r104 UTSW 17 20030026 missense probably benign 0.00
R5270:Vmn2r104 UTSW 17 20038266 missense probably damaging 1.00
R5279:Vmn2r104 UTSW 17 20041884 missense probably benign 0.07
R5311:Vmn2r104 UTSW 17 20029901 missense probably damaging 1.00
R5370:Vmn2r104 UTSW 17 20030188 missense probably damaging 0.97
R5461:Vmn2r104 UTSW 17 20030081 missense probably damaging 1.00
R5683:Vmn2r104 UTSW 17 20040719 nonsense probably null
R5795:Vmn2r104 UTSW 17 20030110 missense probably benign 0.02
R5795:Vmn2r104 UTSW 17 20030282 missense possibly damaging 0.89
R5970:Vmn2r104 UTSW 17 20029471 missense probably benign 0.01
R5983:Vmn2r104 UTSW 17 20041708 missense probably damaging 1.00
R5992:Vmn2r104 UTSW 17 20029485 missense probably damaging 1.00
R6066:Vmn2r104 UTSW 17 20038311 missense possibly damaging 0.69
R6156:Vmn2r104 UTSW 17 20041647 missense probably damaging 1.00
R6182:Vmn2r104 UTSW 17 20030245 missense probably benign 0.16
R6245:Vmn2r104 UTSW 17 20041567 missense possibly damaging 0.69
R6333:Vmn2r104 UTSW 17 20029586 missense probably benign 0.30
R6573:Vmn2r104 UTSW 17 20042225 missense probably damaging 1.00
R7101:Vmn2r104 UTSW 17 20030096 missense possibly damaging 0.65
R7123:Vmn2r104 UTSW 17 20040826 missense probably benign 0.12
R7485:Vmn2r104 UTSW 17 20029475 missense probably benign 0.01
R7514:Vmn2r104 UTSW 17 20029529 missense probably damaging 1.00
R7634:Vmn2r104 UTSW 17 20041709 missense possibly damaging 0.48
R7958:Vmn2r104 UTSW 17 20042726 missense probably benign
R8031:Vmn2r104 UTSW 17 20042786 missense probably benign 0.34
R8094:Vmn2r104 UTSW 17 20030221 missense possibly damaging 0.77
R8191:Vmn2r104 UTSW 17 20030203 missense possibly damaging 0.89
R8308:Vmn2r104 UTSW 17 20040778 missense possibly damaging 0.55
RF007:Vmn2r104 UTSW 17 20048040 missense probably benign 0.36
Z1177:Vmn2r104 UTSW 17 20029789 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATATGGCTTAGTTGAATGTGGC -3'
(R):5'- ATGAATAGAGAGCCTCAGCAGC -3'

Sequencing Primer
(F):5'- GGCTTTTTCTTTTCAGTGTACAAAG -3'
(R):5'- AGCCTCAGCAGCAGTCTGAAG -3'
Posted On2014-12-04