Incidental Mutation 'R0312:Fryl'
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 038522-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R0312 (G1)
Quality Score225
Status Validated
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73072888 bp
Amino Acid Change Histidine to Leucine at position 1642 (H1642L)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect probably damaging
Transcript: ENSMUST00000094700
AA Change: H1642L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: H1642L

Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101127
AA Change: H1642L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: H1642L

Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175890
Predicted Effect probably benign
Transcript: ENSMUST00000201277
Predicted Effect unknown
Transcript: ENSMUST00000202381
AA Change: H511L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202413
Predicted Effect probably benign
Transcript: ENSMUST00000202697
Meta Mutation Damage Score 0.9655 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.3%
  • 20x: 90.3%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,284,369 I4269N probably damaging Het
Abcb5 G T 12: 118,872,837 A1113D probably damaging Het
Adcy1 G T 11: 7,149,538 A673S probably benign Het
Apob T A 12: 8,009,034 H2505Q probably benign Het
Arhgap12 A G 18: 6,061,982 probably benign Het
Bcl9 C T 3: 97,209,411 E656K probably benign Het
Bnc1 C T 7: 81,977,324 R106H possibly damaging Het
Ccdc54 T C 16: 50,590,802 K34E possibly damaging Het
Cfap65 G A 1: 74,904,067 R1600W probably damaging Het
Csmd1 A T 8: 15,984,760 N2470K probably damaging Het
Cspp1 T C 1: 10,058,829 probably benign Het
Dgkz A T 2: 91,938,339 I699N probably damaging Het
Dhx40 G A 11: 86,771,949 T639I probably damaging Het
Dlg1 A G 16: 31,790,267 T227A probably benign Het
Dnah10 G A 5: 124,796,369 probably benign Het
Dnah3 T A 7: 120,045,659 K1133M probably damaging Het
Dock5 G C 14: 67,795,991 F976L possibly damaging Het
Evc C T 5: 37,328,541 C97Y possibly damaging Het
Fbxw7 T C 3: 84,967,569 probably benign Het
Fggy A C 4: 95,844,185 D112A probably damaging Het
Fpgs A G 2: 32,684,801 Y435H probably damaging Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gda T A 19: 21,417,005 I237F probably damaging Het
Glt1d1 A G 5: 127,691,070 N247S probably damaging Het
Gm7647 T C 5: 94,962,980 S7P probably benign Het
Gpr31b C T 17: 13,051,611 V224I probably damaging Het
Hlf G A 11: 90,387,875 P121L possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ism1 G T 2: 139,678,672 M1I probably null Het
Kansl1l T C 1: 66,778,106 N365S probably null Het
Lama1 T C 17: 67,775,851 L1368P possibly damaging Het
Lima1 A G 15: 99,781,087 V491A possibly damaging Het
Lrch1 G T 14: 74,947,594 H23N possibly damaging Het
Lrp1b A G 2: 41,282,171 V1488A probably damaging Het
Lrp8 T C 4: 107,806,855 probably benign Het
Lrrc8e A G 8: 4,235,733 S653G probably benign Het
Mnat1 A G 12: 73,181,784 T141A possibly damaging Het
Mpeg1 C A 19: 12,462,403 N408K probably damaging Het
Myo7b T C 18: 32,014,337 E51G possibly damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naa35 A G 13: 59,609,581 T257A probably benign Het
Obox5 T A 7: 15,757,560 H8Q probably damaging Het
Olfr196 A T 16: 59,167,839 F101L probably benign Het
Olfr350 A T 2: 36,850,360 I105L probably benign Het
Olfr638 T C 7: 104,004,025 V250A probably damaging Het
Phldb2 G T 16: 45,789,047 T732N probably damaging Het
Phyhip G T 14: 70,466,970 A210S possibly damaging Het
Pik3r4 A G 9: 105,686,210 D1262G probably damaging Het
Pip G A 6: 41,849,864 E48K possibly damaging Het
Plk4 C T 3: 40,813,547 L74F probably damaging Het
Prdm14 G A 1: 13,118,807 R438W probably damaging Het
Rab19 G A 6: 39,384,089 R57H probably benign Het
Rtl1 G T 12: 109,590,227 P1726Q probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Skint6 A T 4: 112,809,100 V1176D possibly damaging Het
Slc12a1 A G 2: 125,226,028 I1012V probably damaging Het
Slc1a3 C T 15: 8,636,237 M509I probably benign Het
Spata18 G A 5: 73,666,881 G35E probably benign Het
Sspo C T 6: 48,455,401 P801L possibly damaging Het
Ugt2b37 C T 5: 87,250,665 G304D probably damaging Het
Vmn2r25 A T 6: 123,828,580 probably benign Het
Xrcc6 C A 15: 82,027,222 probably null Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4664:Fryl UTSW 5 73090679 missense possibly damaging 0.80
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 splice site probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
R7917:Fryl UTSW 5 73054532 missense probably damaging 1.00
R7920:Fryl UTSW 5 73101807 splice site probably null
R8110:Fryl UTSW 5 73133277 missense probably benign 0.10
R8120:Fryl UTSW 5 73071184 missense probably benign 0.01
R8143:Fryl UTSW 5 73050339 missense probably benign 0.00
R8207:Fryl UTSW 5 73100500 splice site probably null
R8263:Fryl UTSW 5 73081005 missense probably damaging 1.00
R8350:Fryl UTSW 5 73068730 missense probably benign
R8359:Fryl UTSW 5 73075933 missense probably benign 0.39
R8387:Fryl UTSW 5 73136320 critical splice donor site probably null
R8403:Fryl UTSW 5 73118447 makesense probably null
R8450:Fryl UTSW 5 73068730 missense probably benign
R8514:Fryl UTSW 5 73085356 missense probably benign
R8536:Fryl UTSW 5 73100353 missense probably damaging 0.99
R8703:Fryl UTSW 5 73090654 missense probably damaging 0.99
R8708:Fryl UTSW 5 73132562 missense probably benign 0.01
R8783:Fryl UTSW 5 73068842 missense probably benign 0.45
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense probably benign
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tcgacatacacagactgtttcc -3'
Posted On2013-04-16