Incidental Mutation 'R2655:Slu7'
ID252680
Institutional Source Beutler Lab
Gene Symbol Slu7
Ensembl Gene ENSMUSG00000020409
Gene NameSLU7 splicing factor homolog (S. cerevisiae)
SynonymsD3Bwg0878e, D11Ertd730e
MMRRC Submission 040430-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2655 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location43433744-43447981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43440648 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 203 (E203G)
Ref Sequence ENSEMBL: ENSMUSP00000137281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020681] [ENSMUST00000126128] [ENSMUST00000151880] [ENSMUST00000178622]
Predicted Effect probably benign
Transcript: ENSMUST00000020681
AA Change: E203G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020681
Gene: ENSMUSG00000020409
AA Change: E203G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 1.3e-90 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126128
SMART Domains Protein: ENSMUSP00000122142
Gene: ENSMUSG00000020409

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149402
Predicted Effect probably benign
Transcript: ENSMUST00000151880
AA Change: E203G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116609
Gene: ENSMUSG00000020409
AA Change: E203G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 160 434 2.4e-91 PFAM
low complexity region 486 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178622
AA Change: E203G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137281
Gene: ENSMUSG00000020409
AA Change: E203G

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
ZnF_C2HC 119 135 4.08e-1 SMART
Pfam:Slu7 161 434 1.6e-112 PFAM
coiled coil region 484 543 N/A INTRINSIC
low complexity region 555 570 N/A INTRINSIC
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Pre-mRNA splicing occurs in two sequential transesterification steps. The protein encoded by this gene is a splicing factor that has been found to be essential during the second catalytic step in the pre-mRNA splicing process. It associates with the spliceosome and contains a zinc knuckle motif that is found in other splicing factors and is involved in protein-nucleic acid and protein-protein interactions. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot5 T A 12: 84,075,876 S411R probably benign Het
Adamts12 A T 15: 11,065,088 N20Y possibly damaging Het
Bbs9 G A 9: 22,504,052 E91K probably damaging Het
Casp4 C A 9: 5,322,894 L57I possibly damaging Het
Cat T C 2: 103,471,846 K169E probably damaging Het
Cav1 A G 6: 17,339,360 Y148C probably damaging Het
Cep112 T C 11: 108,437,201 probably benign Het
Chaf1b T C 16: 93,891,511 S165P probably damaging Het
Crat A G 2: 30,402,691 S115P probably damaging Het
Eif2b1 A G 5: 124,576,854 S120P probably damaging Het
Epor A G 9: 21,960,720 S236P probably damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Igfbpl1 T C 4: 45,816,289 T179A probably damaging Het
Ighv14-4 T G 12: 114,176,448 Y114S probably damaging Het
Ipcef1 T C 10: 6,979,657 I29V probably benign Het
Junb A G 8: 84,977,508 S308P probably damaging Het
Kcnh5 T C 12: 75,114,540 E198G probably damaging Het
Ltbp1 G A 17: 75,005,983 R33H possibly damaging Het
Map3k20 C A 2: 72,433,420 T471K probably damaging Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr642 T C 7: 104,049,431 M308V probably benign Het
Olfr955 A T 9: 39,470,628 S33T probably benign Het
Patj T C 4: 98,437,450 V508A possibly damaging Het
Pkd1 T C 17: 24,576,490 V2319A probably damaging Het
Pnpla7 A G 2: 25,052,318 Y83C probably damaging Het
Prb1 G C 6: 132,210,462 Q19E unknown Het
Rasa3 T C 8: 13,595,373 T189A possibly damaging Het
Reck T A 4: 43,938,966 D777E probably benign Het
Rfx6 A G 10: 51,693,777 probably benign Het
Serpinb13 A G 1: 107,000,427 D259G probably damaging Het
Slit2 G A 5: 48,189,575 R253Q possibly damaging Het
Syt4 A T 18: 31,443,544 D252E probably benign Het
Tpte A G 8: 22,311,278 probably null Het
Ttc25 T A 11: 100,553,579 W237R probably damaging Het
Ttll7 A G 3: 146,947,621 Y729C probably damaging Het
Usp35 T A 7: 97,312,147 T691S probably benign Het
Vmn1r211 A G 13: 22,852,416 V27A probably benign Het
Vmn2r72 T C 7: 85,751,269 T191A possibly damaging Het
Vwa5b1 C T 4: 138,594,303 G393D probably damaging Het
Other mutations in Slu7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Slu7 APN 11 43439260 missense probably damaging 1.00
IGL02212:Slu7 APN 11 43440642 missense probably benign 0.05
IGL02657:Slu7 APN 11 43442022 splice site probably null
IGL02671:Slu7 APN 11 43445475 splice site probably null
IGL02702:Slu7 APN 11 43438892 splice site probably benign
IGL02720:Slu7 APN 11 43445203 missense probably benign 0.00
IGL02831:Slu7 APN 11 43442653 nonsense probably null
IGL03104:Slu7 APN 11 43442056 missense probably benign 0.36
IGL03106:Slu7 APN 11 43442630 missense possibly damaging 0.46
R0571:Slu7 UTSW 11 43441578 critical splice donor site probably null
R1498:Slu7 UTSW 11 43438217 missense possibly damaging 0.78
R1753:Slu7 UTSW 11 43439268 missense probably benign 0.40
R1789:Slu7 UTSW 11 43445242 missense probably benign 0.00
R2941:Slu7 UTSW 11 43444757 missense probably benign 0.06
R3916:Slu7 UTSW 11 43440684 splice site probably null
R3917:Slu7 UTSW 11 43440684 splice site probably null
R4084:Slu7 UTSW 11 43443391 missense probably benign 0.03
R4393:Slu7 UTSW 11 43439269 missense possibly damaging 0.89
R5656:Slu7 UTSW 11 43443418 missense probably benign 0.03
R5884:Slu7 UTSW 11 43443418 missense probably benign 0.03
R6320:Slu7 UTSW 11 43441489 missense probably benign 0.22
R6517:Slu7 UTSW 11 43438148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAGCTAGCTCTAAGGACC -3'
(R):5'- TGTCCCAAGCACATACACTCTG -3'

Sequencing Primer
(F):5'- GAACTCACTTGTAGACCATGCTGG -3'
(R):5'- AACACTGAGTTGCTTGGAGC -3'
Posted On2014-12-04