Incidental Mutation 'R2859:Abca17'
ID 252681
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 040449-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2859 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24500288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1301 (Y1301C)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect possibly damaging
Transcript: ENSMUST00000039324
AA Change: Y1301C

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: Y1301C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121226
AA Change: Y1301C

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: Y1301C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Meta Mutation Damage Score 0.5180 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amfr A T 8: 94,731,842 (GRCm39) N11K probably damaging Het
Cadm3 A G 1: 173,174,112 (GRCm39) S34P possibly damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,619,782 (GRCm39) probably benign Het
Cdh23 C T 10: 60,218,432 (GRCm39) probably null Het
Ceacam1 T A 7: 25,173,442 (GRCm39) I249F probably damaging Het
Cuzd1 C T 7: 130,917,863 (GRCm39) V246M probably damaging Het
Ehd2 A T 7: 15,698,054 (GRCm39) V61E probably damaging Het
Fibin C T 2: 110,192,542 (GRCm39) R200H probably damaging Het
Fmo9 A C 1: 166,501,236 (GRCm39) F237C probably damaging Het
Garin3 T C 11: 46,296,039 (GRCm39) I137T probably damaging Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Iqgap3 C A 3: 88,014,903 (GRCm39) S873* probably null Het
Ism2 T C 12: 87,346,437 (GRCm39) M15V unknown Het
Itk T G 11: 46,235,662 (GRCm39) probably benign Het
Mastl C A 2: 23,029,979 (GRCm39) C249F probably damaging Het
Mink1 T C 11: 70,503,334 (GRCm39) V1143A probably damaging Het
Mrgprb4 T A 7: 47,848,084 (GRCm39) R281S possibly damaging Het
Mthfd1 T C 12: 76,335,699 (GRCm39) Y258H probably damaging Het
Ntmt1 A G 2: 30,712,377 (GRCm39) H140R probably damaging Het
Or1j12 T C 2: 36,343,142 (GRCm39) S182P probably benign Het
Or3a10 C T 11: 73,935,653 (GRCm39) G149D possibly damaging Het
Or3a1b T C 11: 74,012,808 (GRCm39) I231T probably damaging Het
Or9e1 T A 11: 58,732,708 (GRCm39) V256E probably benign Het
Parm1 A G 5: 91,742,165 (GRCm39) T178A possibly damaging Het
Patl1 T C 19: 11,901,195 (GRCm39) F282L probably damaging Het
Phospho2 T C 2: 69,626,195 (GRCm39) V117A possibly damaging Het
Ppp4r3a T C 12: 101,008,906 (GRCm39) probably null Het
Pramel29 A G 4: 143,936,192 (GRCm39) S23P probably benign Het
Rbm17 A G 2: 11,595,515 (GRCm39) F230S possibly damaging Het
Robo3 C A 9: 37,339,400 (GRCm39) G196* probably null Het
Samhd1 A G 2: 156,948,149 (GRCm39) probably null Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Thbs4 A G 13: 92,927,216 (GRCm39) F91S probably benign Het
Trim34b A T 7: 103,985,439 (GRCm39) N358I probably benign Het
Ulk1 A G 5: 110,942,495 (GRCm39) L255P probably damaging Het
Vmn2r104 T A 17: 20,268,455 (GRCm39) I5F possibly damaging Het
Vrk2 C A 11: 26,433,324 (GRCm39) S286I possibly damaging Het
Zswim3 T C 2: 164,662,309 (GRCm39) L263P probably damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,553,240 (GRCm39) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,518,034 (GRCm39) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6819:Abca17 UTSW 17 24,506,767 (GRCm39) missense probably benign 0.01
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,554,564 (GRCm39) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGGACCCCTCTGATATGGAAAC -3'
(R):5'- TGCTAACAGTGATGCTTCTCTGG -3'

Sequencing Primer
(F):5'- GACCCCTCTGATATGGAAACGTATAG -3'
(R):5'- ATGCTTCTCTGGTAATATTGGCTAC -3'
Posted On 2014-12-04