Incidental Mutation 'R2861:Capn2'
ID252695
Institutional Source Beutler Lab
Gene Symbol Capn2
Ensembl Gene ENSMUSG00000026509
Gene Namecalpain 2
SynonymsCapa-2, Capa2, m-calpain
MMRRC Submission 040451-MU
Accession Numbers

Genbank: NM_009794 ; MGI: 88264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2861 (G1)
Quality Score206
Status Validated
Chromosome1
Chromosomal Location182467260-182517608 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 182472920 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068505]
Predicted Effect probably benign
Transcript: ENSMUST00000068505
SMART Domains Protein: ENSMUSP00000068895
Gene: ENSMUSG00000026509

DomainStartEndE-ValueType
CysPc 27 352 1.62e-186 SMART
calpain_III 355 510 3.47e-90 SMART
low complexity region 513 532 N/A INTRINSIC
EFh 576 604 5.86e0 SMART
EFh 606 634 3.21e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194961
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes the large subunit of the ubiquitous enzyme, calpain 2. Multiple heterogeneous transcriptional start sites in the 5' UTR have been reported. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous inactivation of this gene leads to complete prenatal lethality. Mice homozygous for one null allele display placental dysfunction, thin ventricular walls, and peripheral vessel failure. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Klhdc10 G A 6: 30,402,140 R48H unknown Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in Capn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02049:Capn2 APN 1 182473954 splice site probably benign
IGL02589:Capn2 APN 1 182484348 missense probably damaging 1.00
IGL02679:Capn2 APN 1 182472584 missense probably benign
IGL03207:Capn2 APN 1 182489013 missense possibly damaging 0.92
E7848:Capn2 UTSW 1 182486594 missense possibly damaging 0.67
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0070:Capn2 UTSW 1 182473869 splice site probably benign
R0540:Capn2 UTSW 1 182492184 nonsense probably null
R0571:Capn2 UTSW 1 182470760 missense probably benign 0.01
R1620:Capn2 UTSW 1 182517137 missense probably damaging 1.00
R1818:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1819:Capn2 UTSW 1 182472597 missense probably benign 0.00
R1822:Capn2 UTSW 1 182472960 missense possibly damaging 0.95
R1880:Capn2 UTSW 1 182489016 missense probably damaging 1.00
R2174:Capn2 UTSW 1 182479725 missense probably benign 0.22
R2391:Capn2 UTSW 1 182478609 missense probably benign 0.01
R2860:Capn2 UTSW 1 182472920 splice site probably benign
R2878:Capn2 UTSW 1 182517233 missense probably benign 0.00
R3052:Capn2 UTSW 1 182487772 missense probably benign 0.06
R4463:Capn2 UTSW 1 182479764 intron probably benign
R4669:Capn2 UTSW 1 182470780 missense probably benign 0.00
R5077:Capn2 UTSW 1 182472573 missense possibly damaging 0.71
R5397:Capn2 UTSW 1 182470706 missense probably damaging 1.00
R5696:Capn2 UTSW 1 182478600 missense possibly damaging 0.79
R6777:Capn2 UTSW 1 182470177 critical splice donor site probably null
R6800:Capn2 UTSW 1 182481480 missense probably damaging 0.99
R7741:Capn2 UTSW 1 182479723 nonsense probably null
R7814:Capn2 UTSW 1 182492146 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAACTCTTGACAGTGACC -3'
(R):5'- TCTGTGAAACCTCTGTGCTTG -3'

Sequencing Primer
(F):5'- CTGGTCACTTATCAGGCATAGG -3'
(R):5'- AAACCTCTGTGCTTGTGTTGG -3'
Posted On2014-12-04