Incidental Mutation 'R2656:Lonrf2'
ID252701
Institutional Source Beutler Lab
Gene Symbol Lonrf2
Ensembl Gene ENSMUSG00000048814
Gene NameLON peptidase N-terminal domain and ring finger 2
Synonyms2900060P06Rik
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location38793645-38836711 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 38815960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039612] [ENSMUST00000147695]
Predicted Effect probably null
Transcript: ENSMUST00000039612
SMART Domains Protein: ENSMUSP00000047372
Gene: ENSMUSG00000048814

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON 301 498 4.1e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147695
SMART Domains Protein: ENSMUSP00000117600
Gene: ENSMUSG00000048814

DomainStartEndE-ValueType
Blast:TPR 22 55 2e-14 BLAST
low complexity region 72 87 N/A INTRINSIC
RING 213 250 1.54e-5 SMART
Pfam:LON_substr_bdg 301 498 2.6e-27 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Lonrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Lonrf2 APN 1 38812535 splice site probably benign
IGL02369:Lonrf2 APN 1 38811832 splice site probably benign
IGL02526:Lonrf2 APN 1 38800710 missense probably benign 0.02
gorged UTSW 1 38804336 missense probably benign 0.05
Swollen UTSW 1 38813389 missense probably benign
R1450:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1527:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1541:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1655:Lonrf2 UTSW 1 38811824 missense probably damaging 0.98
R1679:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1681:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1711:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1732:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1758:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1768:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1795:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1831:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1832:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R1833:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R2044:Lonrf2 UTSW 1 38807050 missense probably benign 0.17
R2054:Lonrf2 UTSW 1 38813276 missense probably benign 0.14
R4084:Lonrf2 UTSW 1 38821151 missense probably benign 0.00
R4775:Lonrf2 UTSW 1 38818059 splice site probably null
R4796:Lonrf2 UTSW 1 38816038 missense probably benign 0.00
R5445:Lonrf2 UTSW 1 38807153 missense probably benign 0.05
R5875:Lonrf2 UTSW 1 38807047 missense probably benign 0.01
R5902:Lonrf2 UTSW 1 38807093 missense probably benign 0.17
R6441:Lonrf2 UTSW 1 38818123 missense possibly damaging 0.76
R6533:Lonrf2 UTSW 1 38813268 missense probably benign 0.08
R6695:Lonrf2 UTSW 1 38813389 missense probably benign
R6930:Lonrf2 UTSW 1 38804336 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CACATCGGTAGCATATGCATCAG -3'
(R):5'- AGACCTTTTCCTCCAGGGTATTTG -3'

Sequencing Primer
(F):5'- CGGTAGCATATGCATCAGTGTATAAG -3'
(R):5'- ATTTGACCATGTGTTTTCTGTTTTTG -3'
Posted On2014-12-04