Incidental Mutation 'R2861:Kcnn1'
ID252726
Institutional Source Beutler Lab
Gene Symbol Kcnn1
Ensembl Gene ENSMUSG00000002908
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 1
SynonymsSK1
MMRRC Submission 040451-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2861 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location70842049-70863258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70846535 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 487 (K487R)
Ref Sequence ENSEMBL: ENSMUSP00000148615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110078] [ENSMUST00000110081] [ENSMUST00000212086] [ENSMUST00000212243] [ENSMUST00000212509] [ENSMUST00000212611]
Predicted Effect probably benign
Transcript: ENSMUST00000110078
AA Change: K444R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105705
Gene: ENSMUSG00000002908
AA Change: K444R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 208 3.7e-59 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 275 369 9.6e-16 PFAM
CaMBD 382 461 1.99e-46 SMART
low complexity region 467 487 N/A INTRINSIC
low complexity region 507 516 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110081
AA Change: K445R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105708
Gene: ENSMUSG00000002908
AA Change: K445R

DomainStartEndE-ValueType
low complexity region 63 76 N/A INTRINSIC
Pfam:SK_channel 90 203 4.9e-51 PFAM
low complexity region 234 245 N/A INTRINSIC
Pfam:Ion_trans_2 274 368 1.7e-15 PFAM
CaMBD 382 462 3.71e-46 SMART
low complexity region 468 488 N/A INTRINSIC
low complexity region 508 517 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212084
AA Change: K102R
Predicted Effect probably benign
Transcript: ENSMUST00000212086
AA Change: K487R

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212243
Predicted Effect probably benign
Transcript: ENSMUST00000212509
AA Change: K441R

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000212611
AA Change: K444R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.1536 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. The protein encoded by this gene is activated before membrane hyperpolarization and is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. The encoded protein is an integral membrane protein that forms a voltage-independent calcium-activated channel with three other calmodulin-binding subunits. This gene is a member of the KCNN family of potassium channel genes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal hippocampal morphology and afterhyperpolarization currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Klhdc10 G A 6: 30,402,140 R48H unknown Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in Kcnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Kcnn1 APN 8 70848062 missense probably benign
IGL00498:Kcnn1 APN 8 70852880 missense probably damaging 1.00
IGL00792:Kcnn1 APN 8 70854716 missense probably benign 0.01
IGL03122:Kcnn1 APN 8 70855080 missense probably damaging 1.00
IGL03137:Kcnn1 APN 8 70850737 missense probably damaging 0.97
IGL03222:Kcnn1 APN 8 70848199 missense probably damaging 1.00
IGL03226:Kcnn1 APN 8 70846491 splice site probably benign
R0586:Kcnn1 UTSW 8 70863869 unclassified probably benign
R1218:Kcnn1 UTSW 8 70852688 missense probably benign 0.07
R1437:Kcnn1 UTSW 8 70844551 missense probably benign 0.03
R1510:Kcnn1 UTSW 8 70864070 unclassified probably benign
R2434:Kcnn1 UTSW 8 70855166 small deletion probably benign
R2860:Kcnn1 UTSW 8 70846535 missense probably benign 0.36
R4327:Kcnn1 UTSW 8 70852663 missense probably damaging 0.99
R4807:Kcnn1 UTSW 8 70848178 missense probably damaging 0.99
R4947:Kcnn1 UTSW 8 70844429 missense probably benign 0.02
R5265:Kcnn1 UTSW 8 70854653 missense probably benign 0.07
R5685:Kcnn1 UTSW 8 70852730 missense probably damaging 1.00
R6108:Kcnn1 UTSW 8 70855156 missense probably benign 0.27
R6523:Kcnn1 UTSW 8 70846525 missense possibly damaging 0.57
R7512:Kcnn1 UTSW 8 70854649 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGGATGCCTGGAATATTACTCATG -3'
(R):5'- CAGAAGTAAGTCTTGGGGTGACTG -3'

Sequencing Primer
(F):5'- ACTCATGAATTTAAACTGAAGAGCC -3'
(R):5'- CTGGTGGTGCATGATGCCC -3'
Posted On2014-12-04