Mutagenetix > Incidental Mutation

Incidental Mutation 'R2656:Adgrf3'

252733

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

MMRRC Submission

040431-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2656 (G1)

Quality Score

209

Status

Not validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30196438 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 864 (V864D)

Ref Sequence

ENSEMBL: ENSMUSP00000085440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]

AlphaFold

Q58Y75

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088117
AA Change: V864D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: V864D

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125367

SMART Domains

Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam22	A	G	5: 8,117,696	C655R	probably damaging	Het
Angptl3	A	G	4: 99,037,964	I444V	probably benign	Het
Atp8b2	C	T	3: 89,941,758	A1090T	probably benign	Het
BC005561	A	G	5: 104,519,315	I568V	probably benign	Het
Bcl2l2	C	T	14: 54,885,432	R47C	probably benign	Het
Ces2a	G	A	8: 104,736,134	M118I	probably benign	Het
Cyp4a29	T	G	4: 115,249,724	L193V	possibly damaging	Het
Dpp8	A	G	9: 65,080,804	Y877C	probably damaging	Het
Enpp6	C	T	8: 47,082,418	R33*	probably null	Het
Fsip2	G	A	2: 82,979,045	D1903N	possibly damaging	Het
Ggt1	T	A	10: 75,581,385	Y5*	probably null	Het
Gm14412	A	T	2: 177,315,200	C301S	unknown	Het
Gpatch2l	T	A	12: 86,288,810	D428E	probably damaging	Het
Grin2b	C	T	6: 135,733,429	G1040S	probably damaging	Het
Has2	T	C	15: 56,681,828	D126G	possibly damaging	Het
Itgam	T	G	7: 128,116,815	L1120R	probably null	Het
Kank4	T	C	4: 98,778,957	N418D	probably damaging	Het
Kcnk3	T	C	5: 30,622,671	V355A	possibly damaging	Het
Lonrf2	C	T	1: 38,815,960		probably null	Het
Lrp1b	A	T	2: 41,511,581	C240S	probably damaging	Het
Mapk8ip3	T	G	17: 24,912,807	E386A	probably damaging	Het
Mtmr14	A	G	6: 113,240,366	I80V	probably benign	Het
Nav2	A	C	7: 49,545,942	D961A	probably damaging	Het
Nmt2	A	G	2: 3,307,013	D107G	probably benign	Het
Nsd1	A	G	13: 55,246,868	K761E	probably damaging	Het
Ogdh	A	G	11: 6,348,678	T641A	probably benign	Het
Ogdhl	T	G	14: 32,332,826	F244V	possibly damaging	Het
Olfr1447	A	G	19: 12,901,666	I38T	probably benign	Het
Olfr1454	A	T	19: 13,063,984	H191L	probably benign	Het
Olfr639	G	A	7: 104,011,865	S279L	probably damaging	Het
Olfr699	T	A	7: 106,790,513	T163S	probably damaging	Het
Pfpl	T	C	19: 12,430,236	I617T	probably benign	Het
Ppfia2	T	G	10: 106,865,407		probably null	Het
Prickle1	T	C	15: 93,503,370	E411G	probably benign	Het
Prpsap2	C	A	11: 61,730,225	M343I	probably benign	Het
Prpsap2	A	G	11: 61,752,891	V72A	probably benign	Het
Ranbp17	A	T	11: 33,243,122	D977E	probably benign	Het
Rin1	T	C	19: 5,052,176	S238P	probably damaging	Het
Scap	C	T	9: 110,374,019	R254W	probably damaging	Het
Scn3a	T	C	2: 65,526,518	D194G	probably damaging	Het
Shisa7	T	C	7: 4,829,819	H481R	possibly damaging	Het
Slc6a6	T	C	6: 91,741,048	Y323H	probably damaging	Het
Tlr9	T	C	9: 106,223,941	S144P	probably benign	Het
Tmem69	T	A	4: 116,553,590	K61M	probably damaging	Het
Ttc21a	A	G	9: 119,941,265	D134G	probably damaging	Het
Ttn	A	G	2: 76,894,270		probably benign	Het
Vwf	A	G	6: 125,555,361	T26A	probably benign	Het
Zbtb16	A	T	9: 48,832,688	I108N	probably damaging	Het
Zc3h7b	T	A	15: 81,780,430	Y497N	probably damaging	Het
Zfp652	A	G	11: 95,749,329	S27G	probably damaging	Het
Zfp808	A	G	13: 62,172,852	T632A	possibly damaging	Het
Znhit6	T	C	3: 145,578,169		probably null	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1695:Adgrf3	UTSW	5	30203555	missense	probably benign	0.05
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3798:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4080:Adgrf3	UTSW	5	30197369	nonsense	probably null
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4819:Adgrf3	UTSW	5	30198444	missense	possibly damaging	0.66
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
R8281:Adgrf3	UTSW	5	30197303	missense	possibly damaging	0.46
R8717:Adgrf3	UTSW	5	30198581	unclassified	probably benign
R8857:Adgrf3	UTSW	5	30197067	nonsense	probably null
R8926:Adgrf3	UTSW	5	30200448	missense	possibly damaging	0.46
R9391:Adgrf3	UTSW	5	30195073	missense	possibly damaging	0.94
R9446:Adgrf3	UTSW	5	30196959	missense	probably benign	0.01
R9522:Adgrf3	UTSW	5	30199484	missense	possibly damaging	0.90
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACCTGGAGGCTGTTGAGAATG -3'
(R):5'- AGCACGTAGTCCTCTCACTG -3'

Sequencing Primer
(F):5'- CTGTTGAGAATGGAAAAGGCGTAGTG -3'
(R):5'- ACGTAGTCCTCTCACTGATGGTG -3'

Posted On

2014-12-04