Incidental Mutation 'R2656:Slc6a6'
ID252739
Institutional Source Beutler Lab
Gene Symbol Slc6a6
Ensembl Gene ENSMUSG00000030096
Gene Namesolute carrier family 6 (neurotransmitter transporter, taurine), member 6
SynonymsTaut
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91684053-91759066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91741048 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 323 (Y323H)
Ref Sequence ENSEMBL: ENSMUSP00000032185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032185]
Predicted Effect probably damaging
Transcript: ENSMUST00000032185
AA Change: Y323H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032185
Gene: ENSMUSG00000030096
AA Change: Y323H

DomainStartEndE-ValueType
Pfam:SNF 41 568 1.2e-241 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205764
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that is a member of a family of sodium and chloride-ion dependent transporters. The encoded protein transports taurine and beta-alanine. There is a pseudogene for this gene on chromosome 21. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutant mice have impaired vision associated with retinal degeneration. In addition to the visual defects, mutant mice exhibit reduced female fertility and decreased levels of taurine in a variety of tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Slc6a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Slc6a6 APN 6 91741170 intron probably benign
IGL01829:Slc6a6 APN 6 91735189 missense probably damaging 1.00
IGL01896:Slc6a6 APN 6 91726069 missense probably damaging 0.97
IGL02087:Slc6a6 APN 6 91735179 missense probably benign
IGL02301:Slc6a6 APN 6 91726056 missense probably benign 0.31
IGL02439:Slc6a6 APN 6 91749827 missense probably damaging 0.99
IGL02555:Slc6a6 APN 6 91748330 unclassified probably benign
animas UTSW 6 91740014 splice site probably null
durango UTSW 6 91723471 missense probably damaging 1.00
R0530:Slc6a6 UTSW 6 91724958 missense probably null 0.04
R1327:Slc6a6 UTSW 6 91726035 missense probably benign 0.00
R1503:Slc6a6 UTSW 6 91740992 missense probably damaging 1.00
R1612:Slc6a6 UTSW 6 91741027 missense probably damaging 1.00
R2033:Slc6a6 UTSW 6 91724910 missense probably benign 0.12
R2146:Slc6a6 UTSW 6 91735180 missense probably benign 0.05
R2309:Slc6a6 UTSW 6 91726196 missense possibly damaging 0.63
R2434:Slc6a6 UTSW 6 91735212 missense probably benign 0.33
R3402:Slc6a6 UTSW 6 91726129 missense probably benign
R3403:Slc6a6 UTSW 6 91726129 missense probably benign
R3978:Slc6a6 UTSW 6 91755052 missense probably benign 0.41
R4236:Slc6a6 UTSW 6 91741276 missense probably damaging 0.98
R4332:Slc6a6 UTSW 6 91723471 missense probably damaging 1.00
R4980:Slc6a6 UTSW 6 91726060 missense probably damaging 1.00
R5326:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5358:Slc6a6 UTSW 6 91735174 missense probably benign 0.28
R5542:Slc6a6 UTSW 6 91735189 missense probably damaging 1.00
R5774:Slc6a6 UTSW 6 91745000 missense probably damaging 1.00
R5839:Slc6a6 UTSW 6 91723317 missense probably damaging 1.00
R5861:Slc6a6 UTSW 6 91741033 missense probably damaging 1.00
R5939:Slc6a6 UTSW 6 91754948 missense probably benign 0.01
R6160:Slc6a6 UTSW 6 91740014 splice site probably null
R6262:Slc6a6 UTSW 6 91755032 missense possibly damaging 0.66
R6265:Slc6a6 UTSW 6 91754915 missense probably damaging 0.99
R6665:Slc6a6 UTSW 6 91726039 missense probably benign 0.38
R6998:Slc6a6 UTSW 6 91752438 missense probably benign 0.21
R7057:Slc6a6 UTSW 6 91741267 missense probably damaging 1.00
R7568:Slc6a6 UTSW 6 91724851 missense probably damaging 1.00
R7768:Slc6a6 UTSW 6 91739965 missense probably damaging 0.99
R8042:Slc6a6 UTSW 6 91741245 missense not run
X0002:Slc6a6 UTSW 6 91723476 missense probably damaging 1.00
X0063:Slc6a6 UTSW 6 91741224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGGGTTCTAGATCTGCC -3'
(R):5'- CACAAAACTGGTACCACTGTTCAG -3'

Sequencing Primer
(F):5'- AGATCTGCCTCTGGGGTTCC -3'
(R):5'- AACTGGTACCACTGTTCAGGCATC -3'
Posted On2014-12-04