Incidental Mutation 'R2656:Mtmr14'
ID252741
Institutional Source Beutler Lab
Gene Symbol Mtmr14
Ensembl Gene ENSMUSG00000030269
Gene Namemyotubularin related protein 14
Synonyms
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R2656 (G1)
Quality Score191
Status Not validated
Chromosome6
Chromosomal Location113237843-113281392 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113240366 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 80 (I80V)
Ref Sequence ENSEMBL: ENSMUSP00000121136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000142938] [ENSMUST00000156141]
Predicted Effect probably benign
Transcript: ENSMUST00000113146
AA Change: I80V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269
AA Change: I80V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129883
AA Change: I80V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269
AA Change: I80V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142938
AA Change: I80V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000121136
Gene: ENSMUSG00000030269
AA Change: I80V

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156141
AA Change: I40V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a myotubularin-related protein. The encoded protein is a phosphoinositide phosphatase that specifically dephosphorylates phosphatidylinositol 3,5-biphosphate and phosphatidylinositol 3-phosphate. Mutations in this gene are correlated with autosomal dominant centronuclear myopathy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 18.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired coordination, decreased exercise endurance, increased muscle fatigue, and muscle atrophy associated with impaired muscular calcium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Mtmr14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Mtmr14 APN 6 113266326 missense probably damaging 0.98
IGL01686:Mtmr14 APN 6 113240430 missense possibly damaging 0.58
IGL02508:Mtmr14 APN 6 113240306 missense probably damaging 1.00
R0147:Mtmr14 UTSW 6 113260666 splice site probably benign
R0394:Mtmr14 UTSW 6 113280688 nonsense probably null
R0529:Mtmr14 UTSW 6 113266252 unclassified probably benign
R0675:Mtmr14 UTSW 6 113270647 missense probably damaging 0.99
R0723:Mtmr14 UTSW 6 113270512 unclassified probably benign
R0785:Mtmr14 UTSW 6 113277947 critical splice donor site probably null
R0866:Mtmr14 UTSW 6 113239582 critical splice donor site probably null
R1721:Mtmr14 UTSW 6 113253732 missense probably damaging 1.00
R1998:Mtmr14 UTSW 6 113277924 missense probably null
R2063:Mtmr14 UTSW 6 113240361 missense probably damaging 1.00
R2192:Mtmr14 UTSW 6 113280739 missense probably damaging 1.00
R4648:Mtmr14 UTSW 6 113260606 missense probably benign 0.12
R5209:Mtmr14 UTSW 6 113253775 nonsense probably null
R5509:Mtmr14 UTSW 6 113253807 critical splice donor site probably null
R5569:Mtmr14 UTSW 6 113240285 missense probably damaging 0.96
R5589:Mtmr14 UTSW 6 113261282 critical splice donor site probably null
R5924:Mtmr14 UTSW 6 113253789 missense probably damaging 1.00
R5997:Mtmr14 UTSW 6 113280614 missense probably damaging 0.97
R6182:Mtmr14 UTSW 6 113269508 missense possibly damaging 0.78
R6658:Mtmr14 UTSW 6 113265476 nonsense probably null
R6752:Mtmr14 UTSW 6 113240397 missense probably damaging 1.00
R7325:Mtmr14 UTSW 6 113269548 missense probably damaging 0.98
R7512:Mtmr14 UTSW 6 113268691 nonsense probably null
R7816:Mtmr14 UTSW 6 113266302 missense probably damaging 1.00
X0023:Mtmr14 UTSW 6 113261255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGCCTCTTTGGATCATG -3'
(R):5'- TCTGAAGCTGTACTACTTGGCC -3'

Sequencing Primer
(F):5'- TGGATCATGGGCCACTTAAGCTC -3'
(R):5'- CCTTAAGTCCGTAAAGATGCCAGG -3'
Posted On2014-12-04