Incidental Mutation 'R2656:Itgam'
ID252756
Institutional Source Beutler Lab
Gene Symbol Itgam
Ensembl Gene ENSMUSG00000030786
Gene Nameintegrin alpha M
SynonymsMac-1a, CD11b/CD18, Mac-1, F730045J24Rik, Mac-1 alpha, complement receptor type 3, Cd11b, complement component receptor 3 alpha, Ly-40, CD11B (p170), CR3
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128062640-128118491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 128116815 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1120 (L1120R)
Ref Sequence ENSEMBL: ENSMUSP00000101849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]
Predicted Effect probably null
Transcript: ENSMUST00000064821
AA Change: L1121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: L1121R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000098015
AA Change: L1120R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: L1120R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106240
AA Change: L1003R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: L1003R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106242
AA Change: L1120R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: L1120R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120355
AA Change: L1121R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: L1121R

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126475
AA Change: L1031R
Predicted Effect probably benign
Transcript: ENSMUST00000134694
SMART Domains Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 39 82 1.1e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha M chain. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This I-domain containing alpha integrin combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as macrophage receptor 1 ('Mac-1'), or inactivated-C3b (iC3b) receptor 3 ('CR3'). The alpha M beta 2 integrin is important in the adherence of neutrophils and monocytes to stimulated endothelium, and also in the phagocytosis of complement coated particles. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice exhibit reduced staphylococcal enterotoxin- induced T cell proliferation, reduced neutrophil adhesion to fibrinogen, and defective homotypic aggregation and reduced degranulation of neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Itgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Itgam APN 7 128085661 missense probably damaging 1.00
IGL00983:Itgam APN 7 128068667 missense probably damaging 0.97
IGL01102:Itgam APN 7 128080273 missense possibly damaging 0.94
IGL01615:Itgam APN 7 128116767 missense possibly damaging 0.80
IGL01845:Itgam APN 7 128112472 missense probably damaging 1.00
IGL01860:Itgam APN 7 128070943 missense probably benign 0.03
IGL01874:Itgam APN 7 128115166 missense probably damaging 0.97
IGL01910:Itgam APN 7 128083776 missense probably damaging 1.00
IGL01994:Itgam APN 7 128101727 missense probably damaging 0.97
IGL02332:Itgam APN 7 128085674 critical splice donor site probably null
IGL02348:Itgam APN 7 128116300 missense possibly damaging 0.52
IGL02394:Itgam APN 7 128084942 missense probably benign 0.01
IGL02491:Itgam APN 7 128116018 missense possibly damaging 0.71
IGL02695:Itgam APN 7 128085941 missense possibly damaging 0.81
IGL02821:Itgam APN 7 128076109 missense probably damaging 0.99
IGL02970:Itgam APN 7 128086043 missense probably benign 0.00
IGL03145:Itgam APN 7 128113019 missense probably benign 0.12
adhesion UTSW 7 128101537 missense probably damaging 0.99
apparition UTSW 7 128112286 splice site probably null
attachment UTSW 7 128113033 missense probably damaging 1.00
Follower UTSW 7 128080264 missense probably damaging 1.00
invisible UTSW 7 128070703 unclassified probably null
obscured UTSW 7 128081634 missense probably damaging 1.00
R0184:Itgam UTSW 7 128086058 missense probably damaging 0.96
R0389:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0443:Itgam UTSW 7 128081634 missense probably damaging 1.00
R0454:Itgam UTSW 7 128107980 missense probably benign 0.01
R0674:Itgam UTSW 7 128116218 missense possibly damaging 0.67
R0828:Itgam UTSW 7 128116505 critical splice donor site probably null
R0925:Itgam UTSW 7 128112238 missense probably benign 0.00
R1086:Itgam UTSW 7 128080264 missense probably damaging 1.00
R1655:Itgam UTSW 7 128115163 missense probably benign 0.00
R1809:Itgam UTSW 7 128070937 missense possibly damaging 0.62
R1823:Itgam UTSW 7 128064732 missense probably benign 0.04
R2105:Itgam UTSW 7 128081712 missense probably damaging 1.00
R2154:Itgam UTSW 7 128085577 missense probably damaging 0.99
R2913:Itgam UTSW 7 128112406 missense probably damaging 1.00
R3116:Itgam UTSW 7 128116029 missense probably damaging 1.00
R3404:Itgam UTSW 7 128070703 unclassified probably null
R3821:Itgam UTSW 7 128112286 splice site probably null
R3822:Itgam UTSW 7 128112286 splice site probably null
R3960:Itgam UTSW 7 128115175 missense probably benign 0.02
R3968:Itgam UTSW 7 128113033 missense probably damaging 1.00
R4192:Itgam UTSW 7 128064732 missense probably benign 0.21
R4400:Itgam UTSW 7 128081658 missense probably damaging 1.00
R4708:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4709:Itgam UTSW 7 128101537 missense probably damaging 0.99
R4742:Itgam UTSW 7 128113073 missense probably damaging 1.00
R4790:Itgam UTSW 7 128116273 missense probably benign 0.01
R4960:Itgam UTSW 7 128115840 missense possibly damaging 0.93
R5109:Itgam UTSW 7 128113218 missense probably benign 0.06
R5190:Itgam UTSW 7 128116317 unclassified probably null
R5379:Itgam UTSW 7 128112388 missense probably damaging 1.00
R5386:Itgam UTSW 7 128107980 missense probably benign 0.00
R6104:Itgam UTSW 7 128116302 missense possibly damaging 0.85
R6122:Itgam UTSW 7 128085652 missense probably damaging 0.99
R6189:Itgam UTSW 7 128112504 missense probably benign 0.04
R6282:Itgam UTSW 7 128084942 missense probably benign 0.01
R6545:Itgam UTSW 7 128107872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATTGTTGGGAGCGGTCAAC -3'
(R):5'- ATCAATGCTGGGGTTAGGCG -3'

Sequencing Primer
(F):5'- ACCCTTGAGCTCAGGGAACTC -3'
(R):5'- GTGGTCATTGTAAACCAGGAGTCATC -3'
Posted On2014-12-04