Incidental Mutation 'R2656:Ces2a'
ID 252760
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms 9130231C15Rik, Ces6
MMRRC Submission 040431-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R2656 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 105460635-105468266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 105462766 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 118 (M118I)
Ref Sequence ENSEMBL: ENSMUSP00000127346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: M118I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: M118I

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159303
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: M118I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: M118I

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,167,696 (GRCm39) C655R probably damaging Het
Adgrf3 A T 5: 30,401,436 (GRCm39) V864D possibly damaging Het
Angptl3 A G 4: 98,926,201 (GRCm39) I444V probably benign Het
Atp8b2 C T 3: 89,849,065 (GRCm39) A1090T probably benign Het
Bcl2l2 C T 14: 55,122,889 (GRCm39) R47C probably benign Het
Cyp4a29 T G 4: 115,106,921 (GRCm39) L193V possibly damaging Het
Dpp8 A G 9: 64,988,086 (GRCm39) Y877C probably damaging Het
Enpp6 C T 8: 47,535,453 (GRCm39) R33* probably null Het
Fsip2 G A 2: 82,809,389 (GRCm39) D1903N possibly damaging Het
Ggt1 T A 10: 75,417,219 (GRCm39) Y5* probably null Het
Gm14412 A T 2: 177,006,993 (GRCm39) C301S unknown Het
Gpatch2l T A 12: 86,335,584 (GRCm39) D428E probably damaging Het
Grin2b C T 6: 135,710,427 (GRCm39) G1040S probably damaging Het
Has2 T C 15: 56,545,224 (GRCm39) D126G possibly damaging Het
Itgam T G 7: 127,715,987 (GRCm39) L1120R probably null Het
Kank4 T C 4: 98,667,194 (GRCm39) N418D probably damaging Het
Kcnk3 T C 5: 30,780,015 (GRCm39) V355A possibly damaging Het
Lonrf2 C T 1: 38,855,041 (GRCm39) probably null Het
Lrp1b A T 2: 41,401,593 (GRCm39) C240S probably damaging Het
Mapk8ip3 T G 17: 25,131,781 (GRCm39) E386A probably damaging Het
Mtmr14 A G 6: 113,217,327 (GRCm39) I80V probably benign Het
Nav2 A C 7: 49,195,690 (GRCm39) D961A probably damaging Het
Nmt2 A G 2: 3,308,050 (GRCm39) D107G probably benign Het
Nsd1 A G 13: 55,394,681 (GRCm39) K761E probably damaging Het
Ogdh A G 11: 6,298,678 (GRCm39) T641A probably benign Het
Ogdhl T G 14: 32,054,783 (GRCm39) F244V possibly damaging Het
Or2ag17 T A 7: 106,389,720 (GRCm39) T163S probably damaging Het
Or51k1 G A 7: 103,661,072 (GRCm39) S279L probably damaging Het
Or5b102 A T 19: 13,041,348 (GRCm39) H191L probably benign Het
Or5b97 A G 19: 12,879,030 (GRCm39) I38T probably benign Het
Pfpl T C 19: 12,407,600 (GRCm39) I617T probably benign Het
Ppfia2 T G 10: 106,701,268 (GRCm39) probably null Het
Prickle1 T C 15: 93,401,251 (GRCm39) E411G probably benign Het
Prpsap2 C A 11: 61,621,051 (GRCm39) M343I probably benign Het
Prpsap2 A G 11: 61,643,717 (GRCm39) V72A probably benign Het
Ranbp17 A T 11: 33,193,122 (GRCm39) D977E probably benign Het
Rin1 T C 19: 5,102,204 (GRCm39) S238P probably damaging Het
Scap C T 9: 110,203,087 (GRCm39) R254W probably damaging Het
Scn3a T C 2: 65,356,862 (GRCm39) D194G probably damaging Het
Shisa7 T C 7: 4,832,818 (GRCm39) H481R possibly damaging Het
Slc6a6 T C 6: 91,718,029 (GRCm39) Y323H probably damaging Het
Thoc2l A G 5: 104,667,181 (GRCm39) I568V probably benign Het
Tlr9 T C 9: 106,101,140 (GRCm39) S144P probably benign Het
Tmem69 T A 4: 116,410,787 (GRCm39) K61M probably damaging Het
Ttc21a A G 9: 119,770,331 (GRCm39) D134G probably damaging Het
Ttn A G 2: 76,724,614 (GRCm39) probably benign Het
Vwf A G 6: 125,532,324 (GRCm39) T26A probably benign Het
Zbtb16 A T 9: 48,743,988 (GRCm39) I108N probably damaging Het
Zc3h7b T A 15: 81,664,631 (GRCm39) Y497N probably damaging Het
Zfp652 A G 11: 95,640,155 (GRCm39) S27G probably damaging Het
Zfp808 A G 13: 62,320,666 (GRCm39) T632A possibly damaging Het
Znhit6 T C 3: 145,283,924 (GRCm39) probably null Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 105,468,047 (GRCm39) makesense probably null
IGL02135:Ces2a APN 8 105,466,813 (GRCm39) missense probably benign 0.00
IGL02529:Ces2a APN 8 105,463,851 (GRCm39) splice site probably benign
IGL02625:Ces2a APN 8 105,466,910 (GRCm39) critical splice donor site probably null
IGL02869:Ces2a APN 8 105,465,691 (GRCm39) missense probably damaging 1.00
IGL03265:Ces2a APN 8 105,464,075 (GRCm39) missense possibly damaging 0.55
IGL03349:Ces2a APN 8 105,460,712 (GRCm39) missense probably damaging 0.99
R0010:Ces2a UTSW 8 105,468,028 (GRCm39) missense probably benign 0.00
R0318:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 1.00
R0477:Ces2a UTSW 8 105,464,169 (GRCm39) missense probably damaging 0.99
R0561:Ces2a UTSW 8 105,464,165 (GRCm39) missense probably benign 0.35
R0619:Ces2a UTSW 8 105,462,742 (GRCm39) missense probably benign 0.00
R1665:Ces2a UTSW 8 105,464,187 (GRCm39) splice site probably benign
R1737:Ces2a UTSW 8 105,467,456 (GRCm39) missense probably damaging 0.98
R2266:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2267:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2269:Ces2a UTSW 8 105,466,822 (GRCm39) missense probably benign 0.02
R2288:Ces2a UTSW 8 105,464,069 (GRCm39) missense probably damaging 1.00
R3176:Ces2a UTSW 8 105,466,010 (GRCm39) splice site probably benign
R3906:Ces2a UTSW 8 105,465,940 (GRCm39) missense probably benign 0.00
R4344:Ces2a UTSW 8 105,463,766 (GRCm39) missense probably damaging 1.00
R4708:Ces2a UTSW 8 105,463,938 (GRCm39) missense probably benign 0.14
R4780:Ces2a UTSW 8 105,463,840 (GRCm39) missense probably damaging 1.00
R5434:Ces2a UTSW 8 105,464,041 (GRCm39) missense probably damaging 0.98
R5763:Ces2a UTSW 8 105,462,756 (GRCm39) missense probably benign 0.00
R5828:Ces2a UTSW 8 105,465,956 (GRCm39) missense probably benign 0.00
R6359:Ces2a UTSW 8 105,462,710 (GRCm39) missense probably benign 0.00
R6440:Ces2a UTSW 8 105,467,954 (GRCm39) missense probably benign 0.12
R7066:Ces2a UTSW 8 105,466,880 (GRCm39) missense probably damaging 0.99
R7267:Ces2a UTSW 8 105,465,672 (GRCm39) missense probably benign 0.20
R7395:Ces2a UTSW 8 105,466,273 (GRCm39) missense probably benign 0.35
R7455:Ces2a UTSW 8 105,464,154 (GRCm39) missense probably damaging 1.00
R7457:Ces2a UTSW 8 105,464,021 (GRCm39) missense possibly damaging 0.87
R7567:Ces2a UTSW 8 105,467,930 (GRCm39) missense probably benign 0.01
R7683:Ces2a UTSW 8 105,463,744 (GRCm39) missense probably benign 0.00
R8328:Ces2a UTSW 8 105,463,998 (GRCm39) missense probably damaging 1.00
R8336:Ces2a UTSW 8 105,465,665 (GRCm39) missense probably damaging 0.97
R9183:Ces2a UTSW 8 105,460,774 (GRCm39) missense possibly damaging 0.95
R9794:Ces2a UTSW 8 105,467,896 (GRCm39) missense probably benign 0.16
X0022:Ces2a UTSW 8 105,462,774 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,461,482 (GRCm39) missense probably damaging 1.00
Z1176:Ces2a UTSW 8 105,460,638 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCATTTTCACATGGCTGGTGG -3'
(R):5'- GCTGACATGACCTTCTTGAAC -3'

Sequencing Primer
(F):5'- ATCATAATGTTAACAGGCATGATGG -3'
(R):5'- GACATGACCTTCTTGAACTCAATAAG -3'
Posted On 2014-12-04