Incidental Mutation 'R2861:Wiz'
ID252761
Institutional Source Beutler Lab
Gene Symbol Wiz
Ensembl Gene ENSMUSG00000024050
Gene Namewidely-interspaced zinc finger motifs
Synonyms
MMRRC Submission 040451-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2861 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32354055-32389401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32361706 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 257 (T257K)
Ref Sequence ENSEMBL: ENSMUSP00000069443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064694] [ENSMUST00000087703] [ENSMUST00000163107] [ENSMUST00000165912] [ENSMUST00000169488] [ENSMUST00000170617]
Predicted Effect probably damaging
Transcript: ENSMUST00000064694
AA Change: T257K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069443
Gene: ENSMUSG00000024050
AA Change: T257K

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 532 554 1.67e-2 SMART
low complexity region 576 588 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
ZnF_C2H2 702 724 1.41e0 SMART
low complexity region 784 793 N/A INTRINSIC
low complexity region 869 887 N/A INTRINSIC
ZnF_C2H2 901 927 1.06e2 SMART
low complexity region 936 956 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087703
AA Change: T257K

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000084993
Gene: ENSMUSG00000024050
AA Change: T257K

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
ZnF_C2H2 175 197 4.72e-2 SMART
ZnF_C2H2 348 370 1.67e-2 SMART
low complexity region 401 412 N/A INTRINSIC
low complexity region 439 458 N/A INTRINSIC
ZnF_C2H2 531 553 1.67e-2 SMART
low complexity region 575 587 N/A INTRINSIC
low complexity region 606 622 N/A INTRINSIC
ZnF_C2H2 701 723 1.41e0 SMART
low complexity region 783 792 N/A INTRINSIC
low complexity region 868 886 N/A INTRINSIC
ZnF_C2H2 900 926 1.06e2 SMART
low complexity region 935 955 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163107
SMART Domains Protein: ENSMUSP00000127943
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165912
SMART Domains Protein: ENSMUSP00000127651
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
ZnF_C2H2 74 96 8.67e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168943
Predicted Effect probably benign
Transcript: ENSMUST00000169488
AA Change: T136K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126253
Gene: ENSMUSG00000024050
AA Change: T136K

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
ZnF_C2H2 54 76 4.72e-2 SMART
ZnF_C2H2 227 249 3.52e-1 SMART
low complexity region 294 318 N/A INTRINSIC
ZnF_C2H2 357 379 1.67e-2 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 448 467 N/A INTRINSIC
ZnF_C2H2 541 563 1.67e-2 SMART
low complexity region 585 597 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ZnF_C2H2 711 733 1.41e0 SMART
low complexity region 793 802 N/A INTRINSIC
low complexity region 878 896 N/A INTRINSIC
ZnF_C2H2 910 936 1.06e2 SMART
low complexity region 945 965 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169741
Predicted Effect probably benign
Transcript: ENSMUST00000170617
SMART Domains Protein: ENSMUSP00000130517
Gene: ENSMUSG00000024050

DomainStartEndE-ValueType
low complexity region 27 35 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous mutant mice die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
C4b T A 17: 34,734,758 S959C probably damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Klhdc10 G A 6: 30,402,140 R48H unknown Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in Wiz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Wiz APN 17 32356919 missense probably benign 0.43
IGL02176:Wiz APN 17 32356902 missense probably damaging 0.96
IGL02212:Wiz APN 17 32368135 missense probably damaging 1.00
IGL02213:Wiz APN 17 32367860 missense probably benign 0.03
IGL02616:Wiz APN 17 32359469 missense probably damaging 1.00
IGL02654:Wiz APN 17 32359350 missense probably damaging 1.00
IGL02833:Wiz APN 17 32357879 missense probably damaging 1.00
IGL03032:Wiz APN 17 32356558 missense probably benign
E0370:Wiz UTSW 17 32355118 missense probably damaging 1.00
IGL03138:Wiz UTSW 17 32359119 missense probably damaging 1.00
PIT4494001:Wiz UTSW 17 32361931 missense probably damaging 1.00
R0197:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0207:Wiz UTSW 17 32357033 missense probably damaging 1.00
R0701:Wiz UTSW 17 32356441 missense probably damaging 1.00
R0883:Wiz UTSW 17 32356441 missense probably damaging 1.00
R1055:Wiz UTSW 17 32387642 missense probably damaging 0.99
R1968:Wiz UTSW 17 32359372 missense probably damaging 1.00
R2225:Wiz UTSW 17 32356925 missense probably damaging 1.00
R2423:Wiz UTSW 17 32361885 missense probably damaging 1.00
R2860:Wiz UTSW 17 32361706 missense probably damaging 1.00
R3056:Wiz UTSW 17 32357697 missense probably benign 0.01
R3755:Wiz UTSW 17 32359132 missense probably damaging 1.00
R3885:Wiz UTSW 17 32357038 missense possibly damaging 0.48
R3933:Wiz UTSW 17 32357898 missense probably damaging 1.00
R4038:Wiz UTSW 17 32359224 missense probably damaging 1.00
R4118:Wiz UTSW 17 32369357 utr 3 prime probably benign
R4181:Wiz UTSW 17 32367985 missense probably damaging 1.00
R4651:Wiz UTSW 17 32357681 missense probably damaging 1.00
R4822:Wiz UTSW 17 32356437 nonsense probably null
R4891:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R4923:Wiz UTSW 17 32361596 missense probably benign 0.01
R5014:Wiz UTSW 17 32359366 missense probably damaging 1.00
R5194:Wiz UTSW 17 32377848 utr 3 prime probably benign
R5254:Wiz UTSW 17 32378496 splice site probably benign
R5944:Wiz UTSW 17 32357697 missense probably benign 0.01
R6015:Wiz UTSW 17 32387600 missense probably damaging 0.99
R6263:Wiz UTSW 17 32360443 intron probably null
R6571:Wiz UTSW 17 32359324 missense probably damaging 1.00
R6823:Wiz UTSW 17 32360421 missense probably damaging 0.99
R7014:Wiz UTSW 17 32361866 missense probably damaging 0.98
R7051:Wiz UTSW 17 32361533 missense probably damaging 1.00
R7144:Wiz UTSW 17 32357628 missense possibly damaging 0.85
R7221:Wiz UTSW 17 32359165 missense probably benign 0.03
R7260:Wiz UTSW 17 32359111 missense probably damaging 0.99
U24488:Wiz UTSW 17 32387675 missense probably damaging 1.00
X0026:Wiz UTSW 17 32387758 start codon destroyed probably null 0.94
Predicted Primers PCR Primer
(F):5'- CCATTGTGCCTTTGGGGAAG -3'
(R):5'- TGCTTTGAGACACGAAAGGGC -3'

Sequencing Primer
(F):5'- AAGTTGGTCGGGGACTCAG -3'
(R):5'- GTTCACATCTGCGGCAGCTTG -3'
Posted On2014-12-04