Incidental Mutation 'R2861:C4b'
ID252763
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 040451-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2861 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34734758 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 959 (S959C)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: S959C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: S959C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 36,965,849 S2079N probably damaging Het
Abca13 A G 11: 9,309,057 S2928G probably damaging Het
Abcc9 C T 6: 142,626,010 V1131M probably benign Het
Abcd1 T A X: 73,737,458 L713H probably damaging Het
Actg1 T C 11: 120,346,801 I52V probably benign Het
Ang G T 14: 51,101,818 D139Y probably damaging Het
Ano1 C T 7: 144,590,012 G1011E probably damaging Het
Apoe T C 7: 19,697,554 Y46C probably damaging Het
Ash1l T C 3: 89,054,478 W2386R probably damaging Het
Asph T C 4: 9,598,277 D250G probably damaging Het
Atr A G 9: 95,874,243 N836S probably benign Het
Btg3 A G 16: 78,364,980 V114A probably damaging Het
C2 T C 17: 34,863,878 T471A possibly damaging Het
Cap1 A T 4: 122,864,725 S221T probably benign Het
Capn2 A T 1: 182,472,920 probably benign Het
Cd38 A G 5: 43,901,433 S130G probably damaging Het
Cd8b1 A G 6: 71,334,101 R202G probably damaging Het
Col22a1 A G 15: 71,815,943 probably null Het
Cps1 A T 1: 67,166,375 E519V probably benign Het
Cyp2c38 G A 19: 39,460,694 R72W probably benign Het
Cyp3a16 A T 5: 145,455,499 Y215* probably null Het
F5 A T 1: 164,184,964 K482N probably damaging Het
Fam212a T C 9: 107,984,404 T238A probably benign Het
Fam45a T C 19: 60,814,794 S80P probably benign Het
Gab1 T C 8: 80,784,753 M488V probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gbx2 C T 1: 89,929,131 R179Q probably damaging Het
Gm11938 C A 11: 99,603,146 R41L probably damaging Het
Gpn1 A G 5: 31,497,320 D72G probably damaging Het
Greb1 A G 12: 16,711,745 S545P probably benign Het
Hsd3b7 T G 7: 127,802,270 L189R probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Il18r1 T C 1: 40,498,557 V494A possibly damaging Het
Itsn2 C A 12: 4,700,315 probably benign Het
Kcnn1 T C 8: 70,846,535 K487R probably benign Het
Kdf1 G A 4: 133,528,541 E190K probably damaging Het
Klhdc10 G A 6: 30,402,140 R48H unknown Het
Lama3 G T 18: 12,453,750 L723F probably damaging Het
Lama5 T C 2: 180,187,247 T2034A probably benign Het
Maged1 G A X: 94,538,924 P366S probably damaging Het
Med14 A G X: 12,719,697 I521T probably benign Het
Mia2 A G 12: 59,154,410 K841E probably damaging Het
Mrgbp G A 2: 180,583,410 R53Q possibly damaging Het
Mum1l1 G A X: 139,236,680 G656S possibly damaging Het
Nmnat2 G A 1: 153,112,425 V267I probably benign Het
Olfr1305 G T 2: 111,873,473 C127* probably null Het
Olfr231 A G 1: 174,117,732 Y95H probably damaging Het
Olfr490 A G 7: 108,286,962 S55P probably damaging Het
Olfr715b T A 7: 107,106,468 H131L probably benign Het
Opn4 A G 14: 34,593,828 probably null Het
Ovgp1 T C 3: 105,986,567 probably benign Het
Parp16 G T 9: 65,233,804 D219Y probably damaging Het
Pitpnm2 G C 5: 124,121,437 H1224Q probably damaging Het
Pkd1 C T 17: 24,565,446 T322I probably benign Het
Pkhd1l1 A C 15: 44,540,871 T2299P probably damaging Het
Plin4 T C 17: 56,106,668 D319G probably damaging Het
Ppp6r3 A C 19: 3,521,782 S122R possibly damaging Het
Rims1 A T 1: 22,432,976 F653I probably benign Het
Rnf113a1 A G X: 37,192,083 E231G probably damaging Het
Rnf41 T C 10: 128,438,154 L225P possibly damaging Het
Ryr2 T C 13: 11,593,093 E876G probably damaging Het
Slc25a10 G A 11: 120,495,177 V115M probably damaging Het
Snx13 T A 12: 35,138,117 I798N probably benign Het
Sri A T 5: 8,067,540 Q178L probably benign Het
Tex14 T G 11: 87,474,417 D62E probably damaging Het
Tshz1 G T 18: 84,014,980 H434Q probably damaging Het
Vegfd A G X: 164,385,883 E57G probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r59 A G 7: 42,047,003 I105T possibly damaging Het
Vmn2r6 G T 3: 64,547,339 T513N probably benign Het
Vmn2r72 A T 7: 85,750,836 I335N probably damaging Het
Wiz G T 17: 32,361,706 T257K probably damaging Het
Xirp1 T C 9: 120,019,815 M1V probably null Het
Xirp1 A G 9: 120,018,378 S41P probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
R7991:C4b UTSW 17 34740352 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTCCGAGGCTAAAGGACAG -3'
(R):5'- GGAAGTTCACATGCCAAGACC -3'

Sequencing Primer
(F):5'- TTCCGAGGCTAAAGGACAGAGAAG -3'
(R):5'- TTCACATGCCAAGACCCTGGG -3'
Posted On2014-12-04