Incidental Mutation 'R2656:Prpsap2'
ID252784
Institutional Source Beutler Lab
Gene Symbol Prpsap2
Ensembl Gene ENSMUSG00000020528
Gene Namephosphoribosyl pyrophosphate synthetase-associated protein 2
Synonyms
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61729650-61762088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61752891 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000126274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004955] [ENSMUST00000168115]
Predicted Effect probably benign
Transcript: ENSMUST00000004955
AA Change: V72A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000004955
Gene: ENSMUSG00000020528
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 21 138 2.4e-40 PFAM
Pfam:Pribosyl_synth 179 363 9.9e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151966
Predicted Effect probably benign
Transcript: ENSMUST00000168115
AA Change: V72A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126274
Gene: ENSMUSG00000020528
AA Change: V72A

DomainStartEndE-ValueType
Pfam:Pribosyltran_N 20 138 3e-41 PFAM
Pfam:Pribosyltran 161 335 3.7e-8 PFAM
Pfam:Pribosyl_synth 179 363 1.6e-103 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Ogdhl T G 14: 32,332,826 F244V possibly damaging Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Prpsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Prpsap2 APN 11 61755451 missense probably benign 0.00
IGL03117:Prpsap2 APN 11 61740989 missense probably benign 0.12
R0372:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R0373:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R0377:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R0486:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R0488:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R0733:Prpsap2 UTSW 11 61741000 missense possibly damaging 0.70
R2656:Prpsap2 UTSW 11 61730225 missense probably benign 0.01
R5027:Prpsap2 UTSW 11 61741004 splice site probably null
R5342:Prpsap2 UTSW 11 61731570 missense probably damaging 1.00
R5861:Prpsap2 UTSW 11 61737044 missense probably damaging 1.00
R5917:Prpsap2 UTSW 11 61737044 missense probably damaging 1.00
R5918:Prpsap2 UTSW 11 61737044 missense probably damaging 1.00
R6489:Prpsap2 UTSW 11 61749064 missense probably damaging 0.96
R6741:Prpsap2 UTSW 11 61740945 critical splice donor site probably null
R6856:Prpsap2 UTSW 11 61730271 missense probably benign 0.11
R7543:Prpsap2 UTSW 11 61744971 missense possibly damaging 0.89
X0019:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0024:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0024:Prpsap2 UTSW 11 61756219 missense probably benign 0.05
X0034:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0035:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0036:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0037:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0038:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0039:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0040:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0052:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0053:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0054:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0058:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0060:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0061:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0062:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
X0063:Prpsap2 UTSW 11 61737000 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCACAGTGCTGCTCTCTGG -3'
(R):5'- TGGTGACACGCTTCATGTC -3'

Sequencing Primer
(F):5'- GCTCAGATTCCACTGTATCTAGAGG -3'
(R):5'- GACACGCTTCATGTCAGTGC -3'
Posted On2014-12-04