Incidental Mutation 'R2656:Ogdhl'
ID252793
Institutional Source Beutler Lab
Gene Symbol Ogdhl
Ensembl Gene ENSMUSG00000021913
Gene Nameoxoglutarate dehydrogenase-like
Synonyms
MMRRC Submission 040431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2656 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32322019-32348151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32332826 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 244 (F244V)
Ref Sequence ENSEMBL: ENSMUSP00000022480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022480] [ENSMUST00000228529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022480
AA Change: F244V

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022480
Gene: ENSMUSG00000021913
AA Change: F244V

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 44 81 2.7e-18 PFAM
Blast:Transket_pyr 118 154 8e-14 BLAST
Pfam:E1_dh 262 588 1.8e-88 PFAM
Transket_pyr 657 870 2.64e-51 SMART
Pfam:OxoGdeHyase_C 874 1019 8.3e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228286
Predicted Effect probably benign
Transcript: ENSMUST00000228529
AA Change: F225V

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to oxoglutarate dehydrogenase (OGDH) of the OGDH complex, which degrades glucose and glutamate. This gene encodes several isoforms, including some that appear to localize to mitochondria. The encoded protein down-regulates the AKT signaling cascade and can suppress the growth of cervical cancer cells. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,117,696 C655R probably damaging Het
Adgrf3 A T 5: 30,196,438 V864D possibly damaging Het
Angptl3 A G 4: 99,037,964 I444V probably benign Het
Atp8b2 C T 3: 89,941,758 A1090T probably benign Het
BC005561 A G 5: 104,519,315 I568V probably benign Het
Bcl2l2 C T 14: 54,885,432 R47C probably benign Het
Ces2a G A 8: 104,736,134 M118I probably benign Het
Cyp4a29 T G 4: 115,249,724 L193V possibly damaging Het
Dpp8 A G 9: 65,080,804 Y877C probably damaging Het
Enpp6 C T 8: 47,082,418 R33* probably null Het
Fsip2 G A 2: 82,979,045 D1903N possibly damaging Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Gm14412 A T 2: 177,315,200 C301S unknown Het
Gpatch2l T A 12: 86,288,810 D428E probably damaging Het
Grin2b C T 6: 135,733,429 G1040S probably damaging Het
Has2 T C 15: 56,681,828 D126G possibly damaging Het
Itgam T G 7: 128,116,815 L1120R probably null Het
Kank4 T C 4: 98,778,957 N418D probably damaging Het
Kcnk3 T C 5: 30,622,671 V355A possibly damaging Het
Lonrf2 C T 1: 38,815,960 probably null Het
Lrp1b A T 2: 41,511,581 C240S probably damaging Het
Mapk8ip3 T G 17: 24,912,807 E386A probably damaging Het
Mtmr14 A G 6: 113,240,366 I80V probably benign Het
Nav2 A C 7: 49,545,942 D961A probably damaging Het
Nmt2 A G 2: 3,307,013 D107G probably benign Het
Nsd1 A G 13: 55,246,868 K761E probably damaging Het
Ogdh A G 11: 6,348,678 T641A probably benign Het
Olfr1447 A G 19: 12,901,666 I38T probably benign Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr639 G A 7: 104,011,865 S279L probably damaging Het
Olfr699 T A 7: 106,790,513 T163S probably damaging Het
Pfpl T C 19: 12,430,236 I617T probably benign Het
Ppfia2 T G 10: 106,865,407 probably null Het
Prickle1 T C 15: 93,503,370 E411G probably benign Het
Prpsap2 C A 11: 61,730,225 M343I probably benign Het
Prpsap2 A G 11: 61,752,891 V72A probably benign Het
Ranbp17 A T 11: 33,243,122 D977E probably benign Het
Rin1 T C 19: 5,052,176 S238P probably damaging Het
Scap C T 9: 110,374,019 R254W probably damaging Het
Scn3a T C 2: 65,526,518 D194G probably damaging Het
Shisa7 T C 7: 4,829,819 H481R possibly damaging Het
Slc6a6 T C 6: 91,741,048 Y323H probably damaging Het
Tlr9 T C 9: 106,223,941 S144P probably benign Het
Tmem69 T A 4: 116,553,590 K61M probably damaging Het
Ttc21a A G 9: 119,941,265 D134G probably damaging Het
Ttn A G 2: 76,894,270 probably benign Het
Vwf A G 6: 125,555,361 T26A probably benign Het
Zbtb16 A T 9: 48,832,688 I108N probably damaging Het
Zc3h7b T A 15: 81,780,430 Y497N probably damaging Het
Zfp652 A G 11: 95,749,329 S27G probably damaging Het
Zfp808 A G 13: 62,172,852 T632A possibly damaging Het
Znhit6 T C 3: 145,578,169 probably null Het
Other mutations in Ogdhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ogdhl APN 14 32333712 missense probably damaging 1.00
IGL00425:Ogdhl APN 14 32346490 missense probably damaging 1.00
IGL01509:Ogdhl APN 14 32337759 missense probably damaging 1.00
IGL01704:Ogdhl APN 14 32337631 splice site probably benign
IGL01760:Ogdhl APN 14 32339937 missense probably damaging 1.00
IGL02376:Ogdhl APN 14 32343318 missense probably damaging 1.00
IGL02508:Ogdhl APN 14 32345174 missense probably damaging 0.99
IGL02834:Ogdhl APN 14 32325946 missense probably damaging 1.00
IGL03100:Ogdhl APN 14 32342072 missense probably benign 0.03
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0044:Ogdhl UTSW 14 32339328 missense possibly damaging 0.94
R0207:Ogdhl UTSW 14 32342037 splice site probably null
R0322:Ogdhl UTSW 14 32337577 missense probably benign 0.09
R0357:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R0417:Ogdhl UTSW 14 32326979 missense probably damaging 1.00
R0677:Ogdhl UTSW 14 32339925 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1470:Ogdhl UTSW 14 32346788 missense probably damaging 1.00
R1541:Ogdhl UTSW 14 32340667 missense possibly damaging 0.80
R1589:Ogdhl UTSW 14 32325865 missense probably benign
R1831:Ogdhl UTSW 14 32337527 missense probably damaging 0.99
R2059:Ogdhl UTSW 14 32332884 missense probably damaging 1.00
R2133:Ogdhl UTSW 14 32325934 missense probably benign
R2179:Ogdhl UTSW 14 32335345 missense probably damaging 0.99
R3607:Ogdhl UTSW 14 32335361 missense probably damaging 1.00
R4617:Ogdhl UTSW 14 32325885 missense probably benign
R4668:Ogdhl UTSW 14 32332536 missense probably benign 0.00
R5419:Ogdhl UTSW 14 32339224 missense probably damaging 1.00
R5575:Ogdhl UTSW 14 32325847 missense possibly damaging 0.60
R5793:Ogdhl UTSW 14 32332773 missense probably damaging 0.96
R5812:Ogdhl UTSW 14 32332865 missense probably damaging 1.00
R5990:Ogdhl UTSW 14 32327114 missense possibly damaging 0.77
R6224:Ogdhl UTSW 14 32342061 missense probably benign 0.09
R7834:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7837:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
R7917:Ogdhl UTSW 14 32340709 missense probably benign 0.05
R7920:Ogdhl UTSW 14 32346458 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCATACGTCGCTTGGAGGTG -3'
(R):5'- AAGTCAGCTGCCTTCCCTTG -3'

Sequencing Primer
(F):5'- TTGGGAGCCCATGAGCATG -3'
(R):5'- CCTTGCTAGGCCCTGCTAG -3'
Posted On2014-12-04